PubMed Health⌕ Search

Biomedical subjects

Lei Ye

Publications and source records attributed to Lei Ye.

30 records · Page 2Linked to original sources
PubMed2005

[Comparison of the thermal conductivity of the related tissues along the meridian and the non-meridian].

OBJECTIVE: To compare the thermal conductivity of the related tissues along meridian line and non-meridian area. METHODS: Forty healthy volunteers were observed with a infrared thermal imaging system. RESULTS: During heating the acupoint or the non-acupoint along the meridian line, the velocity of spreading of the temperature-increasing response along the meridian line was more easy and rapid, with a definite direction. However, during heating the non-meridian spots, the change of temperature was confined to the local area, with no definite direction. The spreading of skin temperature response along the meridian line was more rapid than the non-meridian area during both the two were heated simultaneously, and finally, 3 infrared radiant tracks along the meridian courses conformed basically with that of the classical three yin- meridians of the hand appeared. CONCLUSION: The thermal conductivity of the related tissues along the meridian line is better than that of non-meridian area and has definite direction, with differences in physical characteristics between them.

Acupuncture Points↗
PubMed2004

Angiomyogenesis for cardiac repair using human myoblasts as carriers of human vascular endothelial growth factor.

This study investigated the potential of human skeletal myoblast carrying human VEGF(165) for angiomyogenesis for cardiac repair. A porcine heart model of chronic infarction was created in 18 female swine by coronary artery ligation. The animals were randomized into: group 1, DMEM injected ( n=6), group 2, myoblast transplanted ( n=5) and group 3, VEGF(165) myoblast transplanted ( n=7). Three weeks later 5 ml DMEM containing 3x10(8) myoblast carrying exogenous genes were injected into 20 sites in left ventricle intramyocardially in groups 2 and 3. Group 1 animals were injected 5 ml DMEM without cells. Animals were kept on 5 mg/kg cyclosporine per day for 6 weeks. Regional blood flow was measured using fluorescent microspheres. The heart was explanted between 6-12 weeks after transplantation for histological studies. Histological examination showed survival of lac-z expressing myoblasts in host tissue. Capillary density at low power field (x100) was 57.13+/-4.20 in group 3 which was significantly higher than the other groups. Regional blood flow was significantly improved 6 and 12 weeks after transplantation, which was 2.41+/-0.11 and 3.39+/-0.11 ml(-1) min(-1) g(-1), respectively, in group 3. Left ventricular ejection fraction increased from 31.25+/-4.09% to 43.0+/-2.68% at 6 weeks in group 3. Human myoblasts are potential transgene carriers for the myocardium, in addition to strengthening the weakened myocardium through myogenesis.

Actins↗
PubMed2004

Molecularly imprinted polymers as antibody and receptor mimics for assays, sensors and drug discovery.

Biological receptors play an important role in affinity-based drug assays, biosensors, and at different stages during the modern drug discovery process. The molecular imprinting technology that has recently emerged has shown great potential for producing biomimetic receptors that challenge their natural counterparts. In this paper, we will overview recent progress in the use of molecularly imprinted polymers for drug assays, assembly of biomimetic sensors, and screening of combinatorial libraries. In addition, examples of using artificially-created binding sites to control synthetic reactions will be discussed. The "screening-of-building blocks" approach is expected to accelerate generation of valuable lead compounds, without the costly synthesis of large chemical libraries.

Antibodies↗
PubMed2004

Autologous skeletal myoblasts transduced with a new adenoviral bicistronic vector for treatment of hind limb ischemia.

OBJECTIVE: We aimed to achieve angiogenic synergism between human vascular endothelial growth factor 165 (VEGF 165 ) and angiopoietin-1 (Ang-1) using a new adenoviral bicistronic vector concurrently with cell therapy to repair an ischemically damaged hind limb in a rabbit model. METHODS: Rabbit autologous primary skeletal myoblasts were isolated and labeled with retrovirally transduced LacZreporter gene, 4,6-diamidino-2-phenylindole (DAPI), and 5-bromo-2'-deoxyuridine (BrdU). Hind limb ischemia was created in 48 female New Zealand White rabbits by means of femoral artery ligation at 8 different places, and was assessed at angiography. Animals were randomized to receive intramuscular injection of either Dulbeco's Modified Eagle Medium (DMEM;group 1, n = 8), nontransduced myoblasts (group 2, n = 10), or myoblasts transduced with Ad-Null (group 3, n = 10), Ad-VEGF (group 4, n = 10), or Ad-Bicis (group 5, n = 8). Six weeks after treatment neovascularization in the limb was assessed at angiography. The animals were euthanized, and tissue was harvested for histologic study. RESULTS: Extensive transplanted myoblast survival was observed in all cell-transplanted groups, as visualized with DAPI, BrdU, and LacZ staining. Angiographic blood vessel count revealed enhanced neovascularization in group 5 (25.14 +/- 5.14) compared with group 4 (13.62 +/- 4.52), group 3 (6.09 +/- 0.09), group 2 (4.67 +/- 3.49), and group 1 (3.18 +/- 7.76). Immunostaining for von Willebrand factor confirmed significantly increased capillary density ( P < .01) at high-power microscopic field in group 5 (19.04 +/- 1.59) compared with group 4 (15.31 +/- 1.55), group 3 (6.53 +/- 0.97), group 2 (5.69 +/- 0.51), and group 1 (3.03 +/- 0.20). CONCLUSION: Simultaneous expression of VEGF and Ang-1 from bicistronic vector transduced skeletal myoblasts potently stimulated enhanced functional neovascularization in a rabbit model of limb ischemia.

Adenoviridae↗
PubMed2004

Therapeutic angiogenesis using vascular endothelial growth factor.

Therapeutic angiogenesis using vascular endothelial growth factor can reduce tissue ischemia by simulating the natural process of angiogenesis. Vascular endothelial growth factor not only stimulates endothelial cells to proliferate and migrate, but also mobilizes endothelial progenitor cells and achieves vascular protection. Besides direct administration of angiogenic proteins, plasmids and viral vectors carrying angiogenic genes have been used. Animal experiments have shown promise with evidence of neovascularization and improved perfusion in the target myocardium. Initial phase I and II clinical trials results are encouraging and reflect the potential success of therapeutic angiogenesis as a clinical modality for the treatment of ischemic heart disease. This review discusses the role of vascular endothelial growth factor in therapeutic angiogenesis, along with the problems and considerations of this approach as a treatment strategy.

Angiogenesis Inducing Agents↗
PubMed2003

High efficiency transduction of human VEGF165 into human skeletal myoblasts: in vitro studies.

We report the transduction of human VEGF165 gene into human myoblast and characterization of the transduced myoblasts for transduction and expression efficiency. Human myoblasts were assessed by immunostaining for desmin expression. A replication incompetent adenoviral vector carrying human VEGF165 was constructed and used for transduction of myoblasts. Immunostaining of transduced myoblasts was used to determine transduction efficiency. Expression efficiency was confirmed by immunoblotting, ELISA and reverse transcription (RT)-PCR analysis using human VEGF165 specific primers (5'-3' = 5'ATGAACTTTCTGCTGTCTTGGGTG and 3'-5' = ACACCGCCTCGGCTTGTCACA3'. Biological activity of the secreted VEGF165 was determined by human umbilical vein endothelial cell proliferation and [H3] thymidine incorporation assays. Human myoblast preparation was >95% pure with 99% viability after transduction. Immunostaining showed >95% VEGF(165) positive myoblasts. Western blotting and ELISA revealed high VEGF165 expression in the transduced myoblasts. Maximum transduction efficiency was achieved by 8 h exposure of myoblasts to virus at 1:1,000 ratio on three consecutive days. Concentration of VEGF165 released in the culture medium peaked (37 +/- 3 ng/ml) at 8 days post-transduction. Cell proliferation assay on human umbilical vein endothelial cells using supernatant from VEGF165 transduced myoblasts revealed extensive proliferation of cells which was suppressed in the presence of anti-human VEGF165 antibody in culture medium and was further confirmed by thymidine incorporation assay. The untransduced myoblasts secreted VEGF165 in vitro (300 +/- 50 pg/ml) that is enhanced many folds (37 +/- 3 ng/ml) in VEGF165 transduced myoblast as determined by ELISA. These studies suggest that human myoblast are potential carriers of human VEGF165 to achieve concurrent angiomyogenesis for cardiac repair.

Adenoviridae↗
PubMed2002

Scintillation proximity assay using molecularly imprinted microspheres.

Molecularly imprinted microspheres were prepared as antibody binding mimics and used in scintillation proximity assay of a beta-adrenergic antagonist, (S)-propranolol. By using small polymer beads, we were able to place an organic scintillator and an "antenna" component in close proximity to the imprinted binding sites. When the radioactive template bound to the polymer, radiation energy was effectively transferred, via the antenna component, to the scintillator to generate a fluorescence signal. Using molecularly imprinted microspheres instead of antibodies, we have demonstrated competitive scintillation proximity assays for (S)-propranolol in both organic and aqueous solvents. The experimental results were further validated by normal ligand binding analysis, where liquid scintillation counting was used for quantification.

Indicators and Reagents↗
PubMedDate not supplied

Non-covalent molecular imprinting with emphasis on its application in separation and drug development.

The molecular imprinting technique can be defined as the formation of specific nano-sized cavities by means of template-directed synthesis. The resulting molecularly imprinted polymers (MIPs), which often have an affinity and a selectivity approaching those of antibody-antigen systems, have thus been coined "artificial antibodies." MIPs are characterized by their high specificity, ease of preparation, and their thermal and chemical stability. They have been widely studied in connection with many potential applications, including their use for separation and isolation purposes, as antibody mimics (biomimetic assays and sensors), as enzyme mimics, in organic synthesis, and in drug delivery. The non-covalent imprinting approach, developed mainly in Lund, has proven to be more versatile than the alternative covalent approach because of its preparation being less complicated and of the broad selection of functional monomers and possible target molecules that are available. The paper presents a review of studies of this versatile technique in the areas of separation and drug development, with emphasis being placed on work carried out in our laboratory.

Drug Compounding↗
PubMedDate not supplied

Skeletal myoblast transplant in heart failure.

Despite recent advances in the prevention and treatment of ischemic heart disease (IHD), treatment of patients with heart failure secondary to myocardial infarction remains a therapeutic challenge. Heart transplantation has emerged as a viable option but is fraught with problems of supply. Mechanical assist devices are extremely expensive and dynamic cardiomyoplasty has shown only limited success in the clinical setting. Recent insights into the pathogenesis of myocardial diseases and the progress made in the field of molecular biology have resulted in the development of new strategies at molecular as well as cellular levels for cardiac muscle repair. One such strategy is to augment ventricular function by means of cellular cardiomyoplasty through intracardiac cell grafting using adult and fetal cardiomyocytes, stem cells, and autologous skeletal myoblasts.

Animals↗