PubMed Health⌕ Search

Biomedical subjects

M A Haidar

Publications and source records attributed to M A Haidar.

At least 19 recordsLinked to original sources
PubMed2006

Estrogen effects on the vaginal pH, flora and cytology in late postmenopause after a long period without hormone therapy.

In this report we evaluated the action of conjugated equine estrogens (CEE) on vaginal symptoms, cytology, pH, and flora in late postmenopausal women without any previous hormone therapy. The study was a randomized, double-blind, placebo-controlled trial with 48 late postmenopausal women who received placebo or unopposed CEE (0.625mg/day of CEE orally) during three months of treatment. Vaginal and sexual complaints were evaluated through daily diary cards. We analyzed vaginal changes through cytology and pH measurements. After three months of treatment, 20% of placebo-treated patients and 80% of the CEE-treated patients reported improvement in vaginal dryness and irritation. In the latter group, the vaginal cells and Lactobacillus increased and the vaginal pH decreased, without other changes in sexual complaints. We concluded that estrogen ameliorated the genital tract of late postmenopausal women without any previous hormone therapy.

Atrophy↗
PubMed2003

The benefits of finasteride for hirsute women with polycystic ovary syndrome or idiopathic hirsutism.

Finasteride has been used frequently in the treatment of prostate hyperplasia, but this drug inhibits 5alpha-reductase and for this reason could be useful for the treatment of hirsutism. The aim of this study was to evaluate the clinical and hormonal effects of finasteride on hirsute women with idiopathic hirsutism or polycystic ovary syndrome. Twenty-four women were randomly divided into two groups: those given placebo and those given finasteride 5 mg/day. The treatment period was 6 months. All patients were evaluated before the beginning of treatment (baseline) and after 3 and 6 months of treatment using clinical examination through Ferriman-Gallwey score, blood pressure, cardiac frequency and body mass index. Also, we collected blood for hormonal determination of levels of prolactin, 17alpha-hydroxyprogesterone, follicle stimulating hormone, luteinizing hormone, total and free testosterone, dehydroepiandrosterone sulfate, androstenedione and dihydrotestosterone. Furthermore, all patients were asked about their concerns and satisfaction with the treatment. The results showed that the Ferriman-Gallwey score in the 6th month of finasteride treatment was significantly lower than at baseline and the 3rd month of this drug treatment. The dihydrotestosterone level in the finasteride group was also significantly reduced compared to that in the placebo group. The other hormones did not show any statistical difference during the study. All the patients treated with finasteride perceived a reduction in hirsutism after 6 months. In conclusion, our data suggest that finasteride may be effective for the treatment of the hirsute woman with idiopathic hirsutism or polycystic ovary syndrome.

17-alpha-Hydroxyprogesterone↗
PubMed2002

A randomized, open-label study of conjugated equine estrogens plus medroxyprogesterone acetate versus tibolone: effects on symptom control, bleeding pattern, lipid profile and tolerability.

OBJECTIVE: To compare the effects of continuous combined conjugated equine estrogens plus medroxyprogesterone acetate (CEE/MPA) with those of tibolone on symptom control, bleeding pattern, lipid profile and tolerability in postmenopausal women. METHODS: This was a randomized, open-label, parallel-group, multicenter study. Generally healthy postmenopausal women with an intact uterus and no contraindications to hormone replacement therapy (HRT) or tibolone were enrolled. Each subject was randomly assigned to receive CEE/MPA 0.625 mg-5.0 mg or tibolone 2.5 mg daily for 13 treatment cycles, each of 28 days. RESULTS: A total of 85 subjects were enrolled and received at least one dose of study medication, of which 76 (89.4%) subjects completed the study (n = 40, CEE/MPA; n = 36, tibolone). The incidence of postmenopausal symptoms decreased significantly over time in both treatment groups, compared with baseline, including significant decreases in the incidence of urogenital and sexual health symptoms. Significant differences in symptom control (other than hot flushes) were observed between treatment groups in a few different cycles for different symptoms, but no consistent or clinically significant trends were observed. No statistically significant differences in the incidence of bleeding were observed between treatment groups after cycle 4. Significant decreases in total cholesterol (5.6%) and low-density lipoprotein (LDL) cholesterol (7.5%) were observed at cycle 13, compared with baseline, in the CEE/MPA group, and significant decreases in high-density lipoprotein (HDL) cholesterol (8.5%) and triglycerides (13.7%) were observed at cycle 13, compared with baseline, in the tibolone group. Significant weight gain was observed at cycle 13 in the tibolone group (3.05 kg), compared with the CEE/MPA group (0.96 kg). The incidences of adverse events were similar in both treatment groups. CONCLUSIONS: Women treated with CEE/MPA or tibolone showed significant improvement of postmenopausal symptoms, including urogenital and sexual health symptoms, and had similar bleeding patterns after four cycles of therapy. CEE/MPA and tibolone each induced a different mix of changes in the lipid profile.

Aged↗
PubMed2001

Ultrastructural aspects of the postmenopausal endometrium after oral or transdermal estrogen administration.

In this report we examined the ultrastructural features of the postmenopausal endometrial cells of women treated with different doses of conjugated equine estrogen (CEE), or transdermal 17beta-estradiol. Eight women with uterine prolapse and at least 5 years of menopause were randomly divided into four groups and treated as follows: (I) no hormonal treatment; (II) 0.625mg/day of CEE orally; (III) 1.25mg/day of CEE orally; (IV) 50microg/day of 17beta-estradiol transdermally. Hormones were administered for 28 days followed by vaginal hysterectomy. Fragments of the endometrium were prepared for transmission electron microscopic analysis. We observed that the postmenopausal endometrium of the untreated group was atrophic with lined superficial epithelial cuboidal cells. The presence of gland and stroma cells with clear cytoplasm containing few organelles and heterochromatin nuclei were also observed. On the contrary, the endometrium of the group that received 0.625mg/day of CEE showed signs of proliferative cells such as the presence of numerous organelles in the cytoplasm and euchromatic nuclei. All of the proliferative effects on the endometrium were more pronounced in the groups that received 1.25mg/day of CEE and 50microg/day of transdermal 17beta-estradiol. We concluded that the ultrastructural proliferative changes of the postmenopausal endometrium induced by 1.25mg/day of CEE were similar to 50microg/day of transdermal 17beta-estradiol.

Administration, Cutaneous↗
PubMed2000

Estrogen, progestogen and tamoxifen increase synaptic density of the hippocampus of ovariectomized rats.

The effects of gonadal steroids or tamoxifen over the synaptic density of the CA1 region of the hippocampus was investigated in ovariectomized (OVX) rats. Chronic oral administration of conjugated equine estrogen, conjugated equine medroxyprogesterone, a combination of both or tamoxifen was performed in ovariectomized (OVX) rats over a period of 60 days. Synaptic density of the stratum radiatum of the CA1 region was evaluated by means of electron microscopy. Significant increases in the range of 34-49% were found for treated animals as compared to OVX controls not subject to hormonal replacement. Our results confirm previously reported effects of estradiol over synaptic density in this region and reports for the first time an effect of medroxyprogesterone (alone or in combination with estrogen) and tamoxifen. Our findings support the notion that hormonal replacement therapy and tamoxifen might have beneficial effects for cognitive function.

Administration, Oral↗
PubMed2000

ATM gene deletion in patients with adult acute lymphoblastic leukemia.

BACKGROUND: Loss of heterozygosity (LOH) at the ATM gene (mutated in ataxia telangiectasia [AT] patients) and ATM protein deficiency occur in 14% and 34%, respectively, of patients with chronic lymphocytic leukemia (CLL). ATM protein deficiency also is associated with aggressive disease and worse patient survival. Considering the aberrations in the ATM gene in CLL and the high rate of incidence of lymphoid neoplasias in AT patients, the authors investigated its incidence rate and significance in patients with adult acute lymphoblastic leukemia (ALL). METHODS: Samples from 36 adults with ALL were analyzed for LOH and homozygous deletion (HD) using a panel of three microsatellite markers located at the ATM gene (D11S2179), the MLL gene (D11S1356), and the BCL1 gene (D11S987) loci. These markers are located within the 11q13-q23 locus. RESULTS: Of the 36 informative cases, 10 (28%) showed deletions (7 LOH and 3 HDs) at the D11S2179 marker. In two patients, the deletions were extended to the MLL gene locus. These deletions were submicroscopic because only 3% (1 of 36) of patients showed abnormalities involving 11q23 using cytogenetic studies. The authors also estimated the levels of ATM protein in 15 ALL patients and 12 healthy volunteers by radioimmunoassay. The ATM protein levels in cases with LOH at the ATM gene were between 15-50% of those from normal bone marrow. In contrast to CLL patients, patients with LOH or HD at the ATM gene locus showed better survival compared with patients without ATM gene deletions (P = 0.003). CONCLUSIONS: LOH of the ATM gene and protein deficiency are common in adult ALL, are not demonstrated at the cytogenetic level, and are associated with a favorable prognosis. The authors speculate that ATM deficiency may increase the sensitivity of leukemic blasts to the chemotherapy used during induction and after disease remission in patients with adult ALL. The relatively high frequency of deletion of the D11S2179 marker compared with the D11S1356 marker suggests that ATM is the target gene of the deletion at the 11q23 locus, and that such deletions may play a role in the pathogenesis of ALL.

Adult↗
PubMed2000

Downregulation of the p53 tumor suppressor gene and upregulation of the bcl-2 gene in retinoic acid receptor alpha-deficient transgenic mice.

We recently demonstrated lymphoma development in transgenic mice deficient in retinoic acid receptor alpha (RARalpha). High incidence of lymphoma development in this transgenic mouse model system was similar to lymphoma development in p53 knockout mice. In an effort to understand the molecular basis of lymphomagenesis in RARalpha-deficient transgenic mice, we compared the levels of RARalpha to the levels of p53 mRNA, and Bcl-2, and Bax proteins in lymphoid and non-lymphoid tissues and in lymphomas derived from the RARalpha-deficient transgenic mice. The p53 mRNA levels were depleted in various tissues including spleen ( approximately 96%), thymus ( approximately 29%) and bone marrow ( approximately 62%) of RARalpha-deficient transgenic mice when compared with the normal littermates, and the reduction in p53 mRNA expression in the various tissues examined was proportional to the reduction in RARalpha expression. Bcl-2 to Bax ratios were highly increased in the lymphoid compartments (spleen >bone marrow >thymus) because of selective overexpression of Bcl-2 protein. In summary, RARalpha downmodulation in this transgenic mouse model system was accompanied by p53 downmodulation and deregulation of Bcl-2 to Bax ratios in the lymphoid compartments.

Animals↗
PubMed1997

Expression profile of MDM-2 proteins in chronic lymphocytic leukemia and their clinical relevance.

The MDM-2 oncoprotein exists in an autoregulatory feedback loop with the tumor suppressor protein p53. Therefore, intracellular levels of these two proteins may play important roles in cell proliferation and tumorigenesis. Several MDM-2 proteins (Mr 35-100 Kd) have been demonstrated in human cell lines. We report here the expression profile of MDM-2 and p53 proteins in 87 cases of chronic lymphocytic leukemia (CLL) as detected by immunoblot analysis. The MDM-2 proteins (p57, p59, p67, and p90) were found to be overexpressed in different combinations in 56/87 (64%) of cases of CLL when compared with normal volunteers. The MDM-2 protein p57 was predominantly overexpressed 46/87 (53%) in CLL. In 22/87 (25%) cases of CLL p57 was overexpressed alone, and in 24/87 (28%) cases it was co-overexpressed with other MDM-2 proteins p59/p67/p90. Six of the 87 cases of CLL showed overexpression of the tumor suppressor protein p53 by immunoblot analysis, and five of those cases also co-overexpress MDM-2 protein p57. No statistically significant correlation of MDM-2 protein overexpression to clinical disease stage and history of previous chemotherapy of CLL patients has been found. However, considering the oncogenic potential of overexpressed MDM-2 proteins, a possible role of MDM-2 proteins in the promotion of CLL disease remains to be evaluated.

Amino Acid Sequence↗
PubMed1997

Electron microscopic localization of lacZ expression in the proximal convoluted tubular cells of the kidney in transgenic mice carrying chimeric erythropoietin/lacZ gene constructs.

Regulated expression of the erythropoietin (EPO) gene in the adult kidney plays a key role in the regulation of erythropoiesis. However, uncertainty exists regarding the type of kidney cells involved in EPO gene expression. We previously showed by light microscopy that the lacZ reporter gene is expressed and inducible by hypoxia/anemia in the proximal convoluted tubular (PCT) cells of the kidneys of transgenic mice carrying the 5'-lacZ construct, in which the lacZ gene was placed downstream of a 7.0-kb mouse EPO gene segment containing 6.5 kb of the 5'-flanking sequence. We, report here the light and transmission electron microscopic examination of lacZ expression in the kidneys of transgenic mice carrying the 5'-lacZ construct and two additional constructs carrying the 6.5-kb 5'-flanking sequence with the body of the gene alone, or along with the 1.2-kb 3'-flanking sequence. The electron microscopic analyses unequivocally demonstrated that lacZ under the regulatory control of the 6.5-kb 5'-flanking sequence with or without the body of the gene and the 1.2-kb 3'-flanking sequence was expressed predominantly in the proximal convoluted tubular cells of the kidney following hypoxia induction.

Anemia↗
PubMed1997

Morphologic and morphometric aspects of the endometrium of postmenopausal women before and after cyclic oestrogen replacement treatment.

OBJECTIVE: The aim of the study is to observe the morphology and morphometry of the endometrium of postmenopausal women treated with cyclic conjugated oestrogens. STUDY DESIGN: Three groups of nine postmenopausal women received cyclic conjugated oestrogens for 21 days (with a seven-day pause) during six months. The endometrial specimens were obtained using a modified Novak suction curet, in the second or third day of the period of drug washout. The slides were stained with haematoxylin and eosin (H.E.) in order to measure epithelial height and determine the gland/stroma ratio. RESULTS: Morphologic examination showed that single daily doses of 0.3 mg of conjugated oestrogens caused discrete endometrial proliferation after three and six months of treatment. However, a more intense effect was observed in women receiving doses of 0.625 and 1.25 mg/day of the hormone, in the same period. Morphometric study revealed significant increases both in epithelial thickness and in the gland-stroma ratio, specially in women receiving higher doses of the conjugated oestrogen (0.625 and 1.25 mg/day). CONCLUSIONS: We concluded that there were marked proliferative alterations without atypias in the endometrium of women that received 0.625 and 1.25 mg of conjugated oestrogens during six months.

Cell Division↗
PubMed1996

Differential expression of lacZ in the liver and kidney of transgenic mice carrying chimeric lacZ-erythropoietin gene constructs with or without its 1.2 kb 3'-flanking sequence.

Erythropoietin (EPO) plays a key role in erythropoiesis and is expressed predominantly in the fetal liver and in the adult kidney. The EPO gene is up-regulated at the transcriptional level under hypoxic/anemic conditions. We studied the role of the 5'- and 3'-flanking sequences of the mouse EPO gene in its tissue-specific and hypoxia-induced expression by developing transgenic mouse lines carrying chimeric EPO-lacZ gene constructs. Transgenic mice carrying a 6.5 kb segment of the 5'-sequence and most of the EPO gene in which lacZ was substituted for exon 1 (5'-lacZ-EPO) demonstrated induction of lacZ expression following hypoxia/ anemia induction in both the liver and kidney of adult mice. However, transgenic mice carrying the above construct along with the 1.2 kb 3'-flanking sequence (5'-lacZ-EPO-3') showed a high level of lacZ expression following hypoxia/anemia induction in adult kidney but not in adult liver. With the aim of further understanding the role of the 3'-flanking sequence in tissue-specific expression of the EPO gene, we studied the interactions of protein factors with this 1.2 kb 3' region and demonstrated that multiple sets of protein factors interact tissue specifically with a 10 bp sequence, TCAAAGATGG, located downstream of the previously characterized 3' hypoxia-responsive enhancer element.

Animals↗
PubMed1996

Abnormal expression of MDM-2 in breast carcinomas.

MDM-2 is a cellular oncoprotein that binds to the p53 protein and abrogates its growth-suppressing function. At least seven MDM-2 mRNAs and five proteins (p90, p85, p76, p74, and p57) have been reported in tissue culture. MDM-2 gene amplification occurs in human sarcomas and high-grade gliomas. MDM-2 overexpression without gene amplification has been reported in leukemias and lymphomas. Here we report MDM-2 mRNA overexpression in 24 (73%) out of 33 cases of human breast carcinoma as compared with normal breast tissue. The MDM-2 overexpression was seen in the absence of MDM-2 gene amplification. MDM-2 protein expression was studied by western blot analysis in 21 of these cases of carcinoma. We found complete concordance between MDM-2 mRNA overexpression and MDM-2 protein levels. MDM-2 proteins were overexpressed in 15 of 21 breast carcinoma tissue samples but not in normal breast tissue controls. Ten of these fifteen cases overexpressed MDM-2 p57 protein, two cases overexpressed both p57 and p90, and three cases overexpressed only p90. MDM-2 overexpression was confirmed by immunohistochemistry. p53 overexpression was also studied by immunohistochemistry, 69% of breast carcinomas that overexpressed the MDM-2 mRNA had detectable nuclear p53 protein. These findings demonstrate that MDM-2 oncoprotein expression is altered in primary human breast carcinomas at both mRNA and protein levels. In addition, our results suggest that MDM-2 p57 protein represents the main MDM-2 protein altered in breast carcinomas.

Blotting, Western↗
PubMed1995

p16INK4A and p15INK4B gene deletions in primary leukemias.

The 9p21 locus has been deleted at a high frequency in a wide variety of tumors. Recently, two genes, p16INK4A and p15INK4B (also called MTS1 and MTS2), have been localized in close proximity at the 9p21 locus, encoding cyclin-dependent kinases 4/6 inhibitors of relative molecular mass 16 kD and 15 kD, respectively and also found to be deleted at a high frequency in tumor cell lines. We analyzed p16INK4A and p15INK4B genes in 178 cases of primary leukemias including 81 cases of chronic lymphocytic leukemia (CLL), seven of hairy cell leukemia (HCL), seven of chronic myelogenous leukemia (CML), 43 of acute myelogenous leukemia (AML), 27 of acute lymphoblastic leukemia (ALL), and 13 of myelodysplastic syndrome (MDS) by Southern blot analyses. The ALL cases showed a relatively high frequency of homozygous deletions (22%, 6 of 27) at the p16INK4A gene locus. Interestingly, of the six cases with p16INK4A homozygous deletions, only three showed homozygous deletions at the p15INK4B gene. In 81 CLL patients, we detected one homozygous and five heterozygous deletions at both the p16INK4A and p15INK4B genes and two heterozygous deletions at the p16INK4A gene alone. Deletion of these two genes in AML cases is relatively low (9%). We did not detect deletions in any of the MDS, HCL, and CML cases examined. Sequence analyses of p16INK4A gene of six CLL cases with heterozygous deletion at this locus showed a 27-bp deletion at the splice acceptor site of intron 1 in one case and changes in the coding sequence in three other cases. The data presented in this report showed that (1) p16INK4A and p15INK4B genes are preferentially deleted homozygously in ALL and heterozygously in CLL cases with frequent mutation in the second allele, and (2) p16INK4A gene appears to be more frequently deleted than p15INK4B gene.

Base Sequence↗
PubMed1995

Multiple patterns of MDM-2 deregulation in human leukemias: implications in leukemogenesis and prognosis.

The human analogue of the mouse double minute-2 (MDM-2) protein binds to p53 protein and abrogates its tumor-suppressing activity. MDM-2 overexpression may represent an alternative mechanism to p53 mutation for escaping the p53-mediated growth control. Interestingly, multiple MDM-2 protein isoforms have been described and the possibility of functional differences between various isoforms has been raised. Previously, we demonstrated significant MDM-2 mRNA overexpression in human leukemias and suggested that MDM-2 overexpression may be a marker of aggressiveness of the disease. Polyclonal antibodies (Ab) have been generated to detect various isoforms of the MDM-2 protein. Using these Abs, we confirmed MDM-2 protein overexpression in leukemias. Furthermore, we observed heterogeneity in the isoforms expressed in various types of leukemias. In addition, we demonstrated that analysis by flow cytometry could be used as a diagnostic tool for detecting altered MDM-2 protein expression in leukemias. Here we review and expand our initial observations and confirm MDM-2 mRNA and protein overexpression by reverse transcription-polymerase chain reaction (RT-PCR), flow cytometry, and western blot analyses. Understanding the possible role of MDM-2 oncogene expression in leukemias may establish the scientific basis for new therapeutic approaches.

Gene Expression Regulation, Leukemic↗
PubMed1991

Sp1 is essential and its position is important for p120 gene transcription: a 35 bp juxtaposed positive regulatory element enhances transcription 2.5 fold.

Human proliferating cell nucleolar antigen p120 is expressed in tumor cells in the early G1 phase of the cell cycle. Deletion analyses of the essential cis-acting region -537/-278 showed that a 58 bp sequence from -457 to -400 is an important cis-acting element. An Sp1 transcription factor binds to the sequence AGAGGCGGGG (-425 to -416) within the -458/-400 cis-acting region. Deletion of the Sp1 binding sequence eliminated transcription. Substitution of the Sp1 box(-437/-406), containing the Sp1 recognition site, for the entire cis-acting region (-537/-278) restored transcription only at a very low level (18%). Deletion of the -537/-278 cis-acting region followed by substitutions showed that the Sp1 box (-437/-406) stimulated transcription 2.4 fold, when juxtaposed and downstream of a 35 bp (-472 GGGCGAGCGTAAGTTCCGGGTGCGGCGGCCGACTA -438) positive regulatory cis-element (PRE) over that by substitution of the Sp1 box alone. When the -406/-278 sequence was downstream of the PRE-Sp1 box, transcription was stimulated 4.4 fold over that produced by substitution of the Sp1 box alone. These results suggest that Sp1 is essential and its proper position in the 5' flanking sequence, juxtaposed and down stream of a 35 bp positive regulatory sequence, is required for efficient transcription.

Base Sequence↗
PubMed1991

Molecular biology of human renin and its gene.

This article describes investigations of several aspects of the molecular biology of the human renin gene and the three-dimensional structure of renin and its precursor, prorenin. Because of the importance of the RAS in hypertension, heart failure, renal failure, and possibly other disorders such as atherosclerosis, it is critical to understand the detailed control of this system. This control involves regulation at the transcriptional level, folding of prorenin, sorting of prorenin to a regulated pathway where it is proteolytically cleaved to renin and released in response to secretogogues, constitutive release of uncleaved prorenin, and nonproteolytic activation of prorenin. Currently there is great interest not only in the control of renin in the kidney, the sole source of circulating renin, but also at extrarenal sites where RAS activity may regulate cardiovascular functions. The renin gene was found to be expressed significantly in the renal juxtaglomerular cells and several other cell types. Most tissue culture cells did not express the gene; exceptions were cultured SK-LMS-1 cells and cAMP-stimulated human lung fibroblasts. Cultured human uterine-placental cells expressed the human renin gene at levels higher than in other cell types assessed. Renin mRNA had the same start site in the placental cells as the kidney and was regulated by calcium ionophores and cAMP. Thus, these cells provide primary nontransformed human cells to study the homologous human promoter. Transfected renin promoters showed cell type-specific expression and cAMP responsiveness in these cells in constructs containing as few as 102 bp of 5'-flanking DNA. DNA upstream from this appears to contain an inhibitory element(s) that may have some tissue specificity in its distribution. The cAMP response is not due to cAMP induction of a transcription factor that secondarily affects the renin promoter. A novel element may be involved, since the promoter does not contain a CRE element that mediates many cAMP responses, and the cells do not appear to respond to another known cAMP-responsive transcription factor, AP-2. Studies with transfected vectors expressing a mutant cAMP-responsive protein kinase A regulatory subunit suggest that cAMP is not responsible for basal renin promoter activity in the placental cells. By contrast, cAMP induces in essence gene activation in WI26VA4 transformed human lung fibroblasts in which renin mRNA levels increase by up to 150-fold in response to forskolin. Thus, cAMP may activate renin gene expression under certain circumstances and tissue-specific renin gene expression may be directed by more than one mechanism.(ABSTRACT TRUNCATED AT 400 WORDS)

Amino Acid Sequence↗
PubMed1990

Regulation of human renin expression in chorion cell primary cultures.

The human renin gene is expressed in the kidney, placenta, and several other sites. The release of renin or its precursor, prorenin, can be affected by several regulatory agents. In this study, primary cultures of human placental cells were used to examine the regulation of prorenin release and renin mRNA levels and of the transfected human renin promotor linked to chloramphenicol acetyltransferase reporter sequences. Treatment of the cultures with a calcium ionophore alone, calcium ionophore plus forskolin (that activates adenylate cyclase), or forskolin plus a phorbol ester increased prorenin release and renin mRNA levels 1.3- to 6-fold, but several classes of steroids did not affect prorenin secretion or renin RNA levels. The transfected renin promoter (584 or 100 base pairs of 5'-flanking DNA) initiated at the correct start site in these cells and forskolin increased its expression 2.5- to 4-fold. Constructs containing renin 5'-flanking DNA linked to a heterologous promoter cotransfected into HeLa cells with either glucocorticoid or estrogen receptor expression vectors were not regulated by dexamethasone or 17 beta-estradiol. These results suggest that (i) the first 584 base pairs of the renin gene 5'-flanking DNA do not contain functional glucocorticoid or estrogen response elements, (ii) placental prorenin release and renin mRNA are regulated by calcium ion and by the combinations of cAMP with either C kinase or calcium ion, and (iii) the first 100 base pairs of the human renin 5'-flanking DNA direct accurate initiation of transcription and can be regulated by cAMP. Thus, some control of renin release in the placenta (and by inference in other tissues) occurs via transcriptional influences on its promoter.

Calcimycin↗