PubMed Health⌕ Search

Biomedical subjects

M A Martín

Publications and source records attributed to M A Martín.

At least 19 recordsLinked to original sources
PubMed2006

Undernutrition does not alter the activation of beta-cell neogenesis and replication in adult rats after partial pancreatectomy.

In previous work, we demonstrated that a 65% protein calorie food restriction started during the third trimester of gestation in rats caused a reduced beta-cell mass at 4 days of life that persisted until adult age. In this study with adult undernourished (U) rats, we investigated 1) whether undernutrition affects the beta-cell growth potential and both beta-cell proliferation and differentiation and 2) the implication of the IGFs, highly responsive to nutritional status, in these processes. To this end, we used the 90% pancreatectomy (Px) procedure in U and control (C) adult rats. The results show that, on day 2 after Px, beta-cell replication was significantly higher in C rats, whereas the beta-cell neogenesis was markedly increased in U/Px rats. Both the serum levels of IGF-I and the liver IGF-I mRNA expression were reduced in adult U rats before and after Px compared with C rats. Pancreatic IGF-I mRNA expression was reduced in U animals on day 0. However, on day 2 after Px, the increase of pancreatic IGF-I mRNA expression was significantly higher in U rats than in C rats. These data suggest that beta-cells still have the capacity to regenerate in the adult U rats, with a higher efficiency than C rats on day 2, and that both beta-cell neogenesis and beta-cell replication are stimulated. The increased pancreatic IGF-I mRNA may be instrumental in these processes.

Age Factors↗
PubMed2006

Mitochondrial activity is modulated by TNFalpha and IL-1beta in normal human chondrocyte cells.

OBJECTIVE: Pro-inflammatory cytokines play an important role in osteoarthritis (OA). In osteoarthritic cartilage, chondrocytes exhibit an alteration in mitochondrial activity. This study analyzes the effect of tumor necrosis factor-alpha (TNFalpha) and interleukin-1beta (IL-1beta) on the mitochondrial activity of normal human chondrocytes. MATERIALS AND METHODS: Mitochondrial function was evaluated by analyzing the activities of respiratory chain enzyme complexes and citrate synthase, as well as by mitochondrial membrane potential (Deltapsim) and adenosine triphosphate (ATP) synthesis. Bcl-2 family mRNA expression and protein synthesis were analyzed by RNase protection assay (RPA) and Western-blot, respectively. Cell viability was analyzed by 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide (MTT) and apoptosis by 4', 6-diamidino-2-phenylindole dihydrochloride (DAPI) stain. Glycosaminoglycans were quantified in supernatant by a dimethyl-methylene blue binding assay. RESULTS: Compared to basal cells, stimulation with TNFalpha (10 ng/ml) and IL-1beta (5 ng/ml) for 48 h significantly decreased the activity of complex I (TNFalpha=35% and IL-1beta=35%) and the production of ATP (TNFalpha=18% and IL-1beta=19%). Both TNFalpha and IL-1beta caused a definitive time-dependent decrease in the red/green fluorescence ratio in chondrocytes, indicating depolarization of the mitochondria. Both cytokines induced mRNA expression and protein synthesis of the Bcl-2 family. Rotenone, an inhibitor of complex I, caused a significant reduction of the red/green ratio, but it did not reduce the viability of the chondrocytes. Rotenone also increased Bcl-2 mRNA expression and protein synthesis. Finally, rotenone as well as TNFalpha and IL-1beta, reduced the content of proteoglycans in the extracellular matrix of normal cartilage. CONCLUSION: These results show that both TNFalpha and IL-1beta regulate mitochondrial function in human articular chondrocytes. Furthermore, the inhibition of complex I by both cytokines could play a key role in cartilage degradation induced by TNFalpha and IL-1beta. These data could be important for understanding of the OA pathogenesis.

Adenosine Triphosphate↗
PubMed2006

Chronic primary intestinal pseudo-obstruction from visceral myopathy.

Chronic intestinal pseudo-obstruction is an uncommon syndrome characterized by relapsing episodes suggesting intestinal obstruction during which no mechanical causes are identified to account for symptoms. Etiologic factors may be manifold. Among them a number of neurologic conditions, gastrointestinal smooth muscle myopathies, endocrino-metabolic and autoimmune diseases, and the use of selected drugs stand out. We report a case of chronic intestinal pseudo-obstruction originating in a sporadic, primary intestinal myopathy that corresponds to no type thus far described. A histological study of the intestinal wall showed disrupted muscle bundles and the presence of interstitial edema. Myocytes had severe degenerative changes, and no alterations were seen in submucosal and myenteric plexus neurons. The activity of enzyme complexes in the mitochondrial respiratory chain, and of thymidine phosphorylase was normal. No mitochondrial DNA changes were seen.

Adult↗
PubMed2005

Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE.

We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP).

Blotting, Southern↗
PubMed2005

Maternal food restriction enhances insulin-induced GLUT-4 translocation and insulin signaling pathway in skeletal muscle from suckling rats.

Restriction of protein calories during stages of immaturity has a major influence on glucose metabolism and increases the risk of type 2 diabetes in adulthood. However, it is known that reduction of food intake alleviates insulin resistance. We previously demonstrated an improved insulin-induced glucose uptake in skeletal muscle of chronically undernourished adult rats. The purpose of this work was to investigate whether this condition is present during suckling, a period characterized by physiological insulin resistance as well as elucidate some of the underlying mechanisms. With this aim, 10-d-old pups from food-restricted dams were studied. We showed that undernourished suckling rats are glucose normotolerants, despite their depressed insulin secretion capacity. The content of the main glucose transporters in muscle, GLUT-4 and GLUT-1, was not affected by undernutrition, but fractionation studies showed an improved insulin-stimulated GLUT-4 translocation. p38MAPK protein, implicated in up-regulation of intrinsic activity of translocated GLUT-4, was increased. These changes suggest an improved insulin-induced glucose uptake associated with undernutrition. Insulin receptor content as well as that of both regulatory and catalytic phosphoinositol 3-kinase subunits was increased by food restriction. Insulin receptor substrate-1-associated phosphoinositol 3-kinase activity after insulin was enhanced in undernourished rats, as was phospho-glycogen synthase kinase-3, in line with insulin hypersensitivity. Surprisingly, protein tyrosine phosphatase-1B association with insulin receptor was also increased by undernutrition. These adaptations to a condition of severely limited nutritional resources might result in changes in the development of key tissues and be detrimental later in life, when a correct amount of nutrients is available, as the thrifty phenotype hypothesis predicts.

Animals↗
PubMed2005

Effect of nitric oxide on mitochondrial respiratory activity of human articular chondrocytes.

OBJECTIVE: To investigate the effect of nitric oxide (NO) on mitochondrial activity and its relation with the apoptosis of human articular chondrocytes. MATERIALS AND METHODS: Mitochondrial function was evaluated by analysing respiratory chain enzyme complexes, citrate synthase (CS) activities, and mitochondrial membrane potential (Delta psi m). The activities of the mitochondrial respiratory chain (MRC) complexes (complex I: NADH CoQ(1) reductase, complex II: succinate dehydrogenase, complex III: ubiquinol cytochrome c reductase, complex IV: cytochrome c oxidase) and CS were measured in human articular chondrocytes isolated from normal cartilage. The Delta psi m was measured by 5,5',6,6'-tetracholoro-1,1',3,3'-tetraethylbenzimidazole carbocyanide iodide (JC-1) using flow cytometry. Apoptosis was analysed by flow cytometry. The mRNA expression of caspases was analysed by ribonuclease protection analysis and the detection of protein synthesis by western blotting. Sodium nitroprusside (SNP) was used as an NO compound donor. RESULTS: SNP at concentrations higher than 0.5 mmol/l for 24 hours induced cellular changes characteristic of apoptosis. SNP elicited mRNA expression of caspase-3 and caspase-7 and down regulated bcl-2 synthesis in a dose and time dependent manner. Furthermore, 0.5 mM SNP induced depolarisation of the mitochondrial membrane at 5, 12, and 24 hours. Analysis of the MRC showed that at 5 hours, 0.5 mM SNP reduced the activity of complex IV by 33%. The individual inhibition of mitochondrial complex IV with azide modified the Delta psi m and induced apoptosis. CONCLUSIONS: This study suggests that the effect of NO on chondrocyte survival is mediated by its effect on complex IV of the MRC.

Adult↗
PubMed2004

Protein-caloric food restriction affects insulin-like growth factor system in fetal Wistar rat.

We have previously shown that fetuses from protein-caloric undernourished pregnant rats (35% of control diet during the last week of pregnancy) at 21.5 d post coitum exhibit increased beta-cell mass. This alteration is correlated with increased insulinemia and total pancreatic insulin content, a pattern similar to that reported in infants of mild diabetic mothers. In this work, we investigated in undernourished fetuses: 1) whether availability of growth factors such as insulin, GH, and IGFs and their binding proteins (IGFBPs) could be implicated in this alteration, and 2) the beta-cell mitogenic response to IGFs in vitro. The results show that maternal undernutrition increases pancreatic IGF-I expression and islet IGF-I receptor content in undernourished fetuses, whereas hepatic IGF-I expression and serum IGF-I levels were decreased. No changes were observed in serum IGF-II, and its expression was diminished in undernourished pancreases and unchanged in the liver, compared with control fetuses. Serum levels and liver and pancreatic mRNA expression of IGFBP-1 were found to be normal in undernourished fetuses, whereas the serum concentration and abundance of IGFBP-2 mRNA in pancreas were increased. Finally, the beta-cell mitogenic response to IGFs in vitro was significantly increased in undernourished fetal islets, compared with controls. In conclusion, in undernourished fetuses the increased beta-cell mass can be related to the stimulation of replicative beta-cell response due to locally increased pancreatic IGF-I mRNA; this effect is perhaps potentiated or favored by the enhanced islet IGF-I receptor content and pancreatic IGFBP-2 gene expression.

Animals↗
PubMed2004

Performance and kinetic evaluation of the anaerobic digestion of two-phase olive mill effluents in reactors with suspended and immobilized biomass.

A lab-scale study was conducted on the mesophilic anaerobic digestion of two-phase olive mill effluents constituted by the mixture of the wash waters derived from the initial cleansing of the olives and those obtained in the washing and purification of virgin olive oil. The digestion was conducted in two continuously stirred tank reactors, one with biomass immobilized on Bentonite (reactor B) and other with suspended biomass used as control (reactor C). The reactors B and C operated satisfactorily between hydraulic retention times of 25.0 and 4.0 days and 25.0 and 5.0 days, respectively. Total chemical oxygen demand (TCOD) efficiencies in the ranges of 88.8-72.1% and 87.9-71.2% were achieved in the reactors with immobilized and suspended biomass, respectively, at organic loading rates of between 0.86 and 5.38 g TCOD/ld and 0.86-4.30 g TCOD/ld, respectively. On comparing both reactors for the same OLRs applied, it was observed that the reactor with support was always more efficient and stable showing higher TCOD, SCOD removal efficiencies and lower VFA/alkalinity ratio values than those found in the control reactor. A mass (TCOD) balance around the reactors allowed the methane yield coefficient, Y(G/S), to be obtained, which gave values of 0.31 and 0.30l CH(4)/g TCOD(removed) for reactors B and C, respectively. The cell maintenance coefficients,k(m), obtained by means of this balance were found to be 0.0024 and 0.0036 g TCOD(removed)/g VSSd, respectively. The volumetric methane production rates correlated with the biodegradable TCOD concentration through an equation of the Michaelis-Menten type for the two reactors studied. This proposed model predicted the behavior of the reactors very accurately showing deviations lower than 10% between the experimental and theoretical values of methane production rates.

Anaerobiosis↗
PubMed2004

Molecular analysis of myophosphorylase deficiency in Dutch patients with McArdle's disease.

We report on 8 Dutch patients with McArdle's disease from 6 unrelated families. Molecular analysis revealed the presence of four previously described mutations: the common R49X mutation, the IVS14+1G>A mutation and the recently reported R269X and Y84X nonsense mutations; and two new molecular defects: a missense mutation R138W in the homozygous state in two siblings, and a frameshift mutation c.1797delT. This first genetic study of patients from The Netherlands with McArdle's disease confirms that the R49X mutation is also the most common in Dutch patients, and that there is genetic heterogeneity within this population. Moreover, our data support the hypothesis that the Y84X mutation is a relatively frequent mutation in McArdle's patients with a Central European background, and expand the already crowded map of mutations within the PYGM gene responsible for McArdle's disease.

Base Sequence↗
PubMed2003

Protein calorie restriction has opposite effects on glucose metabolism and insulin gene expression in fetal and adult rat endocrine pancreas.

We previously demonstrated that fetuses from undernourished pregnant rats exhibited increased beta-cell mass and hyperinsulinemia, whereas keeping food restriction until adult age caused reduced beta-cell mass, hypoinsulinemia, and decreased insulin secretion. Because these alterations can be related to insulin availability, we have now investigated early and long-term effects of protein calorie food restriction on insulin mRNA levels as well as the possible mechanisms that could modulate the endogenous insulin mRNA content. We used fetuses at 21.5 days of gestation proceeding from food-restricted rats during the last week of pregnancy and 70-day-old rats undernourished from day 14 of gestation until adult age and with respective controls. Insulin mRNA levels, glucose transporters, and total glycolysis and mitochondrial oxidative fluxes were evaluated. We additionally analyzed undernutrition effects on signals implicated in glucose-mediated insulin gene expression, especially pancreatic duodenal homeobox-1 (PDX-1), stress-activated protein kinase-2 (p38/SAPK2), and phosphatidylinositol 3-kinase. Undernourished fetuses showed increased insulin mRNA, oxidative glucose metabolism, and p38/SAPK2 levels, whereas undernutrition until adult age provoked a decrease in insulin gene expression, oxidative glucose metabolism, and PDX-1 levels. The results indicate that food restriction caused changes in insulin gene expression and content leading to alterations in glucose-stimulated insulin secretion. The molecular events, increased p38/SAPK2 levels in fetuses and decreased PDX-1 levels in adults, seem to be the responsible for the altered insulin mRNA expression. Moreover, because PDX-1 activation appears to be regulated by glucose-derived metabolite(s), the altered glucose oxidation caused by undernutrition could in some manner affect insulin mRNA expression.

Animals↗
PubMed2003

Splicing mosaic of the myophosphorylase gene due to a silent mutation in McArdle disease.

The authors report the molecular findings in a patient with McArdle disease who harbored a silent polymorphism (K608K) in the myophosphorylase gene. cDNA studies demonstrated that this polymorphism leads to a severe mosaic alteration in mRNA splicing, including exon skipping, activation of cryptic splice-sites, and exon-intron reorganizations. These findings suggest that, in patients with McArdle disease in whom no pathogenic mutation has been found, any a priori silent polymorphism should be re-evaluated as a putative splicing mutation.

Alternative Splicing↗
PubMed2003

Detection and characterization of cyclodextrin complexes with beta-carboline derivatives by spectroscopic techniques.

beta-Carboline alkaloids exhibit a great variety of pharmacological activities. The solid inclusion complexes of harmane and harmine with beta-cyclodextrin and also with hydroxypropyl-beta-cyclodextrin, have been prepared following different procedures. IR and NMR spectroscopies were employed to verify the interaction of the guest molecules with the cyclodextrin cavities. The differences observed in the IR and NMR spectra are in agreement with those described in the literature for other guest molecules. The shifts in the 13C- and 1H-NMR spectra confirm the existence of the inclusion complexes. The fluorescence emission spectra of these complexes dissolved in buffered aqueous solution (pH 7.3) exhibit the characteristic peaks of the cationic form for harmane alkaloids. The neutral bands are not present for the free alkaloids in aqueous solutions. Fluorescence quenching emission of the complexes is compared to that of the corresponding free alkaloids.

Carbolines↗
PubMed2003

Myoglobinuria and COX deficiency in a patient taking cerivastatin and gemfibrozil.

The authors describe a patient who presented with myoglobinuria after starting cerivastatin-gemfibrozil therapy. Muscle histochemistry revealed ragged-red fibers and cytochrome c oxidase negative (COX) fibers, and biochemistry showed a defect of COX activity. Immunoblot analysis showed a 60% reduction of COX I and COX II polypeptides. Cerivastatin myotoxicity might be related to a depletion of essential metabolites needed to anchor COX subunit I to mitochondrial membrane.

Aged↗