Independence for people with disabilities. A physician's primer on assistive technology.
Explore the source record for details and available documents.
Persons with Disabilities↗
Biomedical subjects
M A Young
Publications and source records attributed to M A Young.
Blocking chloride channels in the rat lens: localized changes in tissue hydration support the existence of a circulating chloride flux.
PURPOSE: To investigate the effects of inhibitors of chloride channels on lens volume and tissue architecture under isotonic conditions. METHODS: Rat lenses were maintained in organ culture under isotonic conditions in the presence of various putative chloride channel inhibitors. The effect of an inhibitor on lens wet mass and tissue morphology was determined by weighing and histologic examination, respectively. RESULTS: Exposure to 100 microM of either 5-nitro-2- (3-phenylpropylamino) benzoic acid (NPPB) or 4, 4'-diisothiocyanatostilbene-2,2'-disulfonic acid (DIDS) caused an increase in wet mass and severe tissue disruption in the lens equatorial region. Two distinctly different zones of tissue damage were evident: a peripheral zone of fiber cell swelling and an inner zone of extensive tissue breakdown. Extracellular space dilations caused the extensive tissue damage in the inner zone and preceded the peripheral fiber cell swellings. That the observed effects were a consequence of the inhibition of chloride channels was supported by (1) the effectiveness of NPPB at the lower dose of 10 microM, (2) the absence of any NPPB effect in chloride-free medium, and (3) an identical effect after exposure to tamoxifen, an inhibitor of the chloride channel regulator p-glycoprotein. CONCLUSIONS: Study results indicate that chloride channels are active in the lens under isotonic conditions. The spatial and temporal pattern of morphologic changes that was observed is consistent with a steady state efflux of chloride ions and water from peripheral fiber cells and a corresponding influx into fiber cells deeper in the lens. These observations may therefore represent the first visualization of the chloride flux postulated by others to be a component of the lens internal circulation system.
4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid↗
Molecular dynamics studies of axis bending in d(G5-(GA4T4C)2-C5) and d(G5-(GT4A4C)2-C5): effects of sequence polarity on DNA curvature.
Gel retardation studies and other experiments indicate that DNA sequences containing the d(GA4T4C)n motif are curved, whereas those of identical composition but with a reverse sequence polarity, the d(GT4A4C)n motif, are straight. Hydroxyl radical cleavage experiments show that d(GA4T4C)n shows a unique signature, whereas d(GT4A4C)n behaves normally. To explain these results at a molecular level, molecular dynamics (MD) simulations were performed on the DNA duplexes d(G5-(GA4T4C)2-C5) and d(G5-(GT4A4C)2-C5) to 3.0 and 2.5 ns, respectively. The MD simulations are based on the Cornell force field implemented in the AMBER 4.1 modeling package and performed in a neutral solution of anionic DNA with K+, Cl- and Mg2+ at concentrations roughly comparable to a ligase buffer. Long range interactions were treated by the particle mesh Ewald method. Analysis of the results shows that the calculated dynamical structure of d(G5-(GA4T4C)2-C5) exhibits strong gross curvature, consistent with the observed behavior. The most significant locus of curvature in the MD structure is found at the central C15-G16 step, with an average roll angle of 12.8(+/-6.40)deg. The d(G5-(GT4A4C)2-C5) MD structure exhibited significantly less gross curvature. Analysis of results indicates that the reduction in gross curvature in the d(G5-(GT4A4C)2-C5) trajectory originates from the effect of the T10-A11 and T20-A21 steps, which showed average roll angles of 12.5(+/-5)deg. These three steps, T10-A11, C15-G16 and T20-A21, are half-helix turns away from one another, and their contributions to concerted bending cancel out. The A-tracts in the MD structure are essentially straight. The dynamical structure of d(G5-(GA4T4C)2-C5) exhibited minor groove deformation comprised of expansion at the 5' end of A-tracts and progressive narrowing towards the 3' end, consistent with and elaborating the interpretation of hydroxyl radical chemical probing results.
Base Sequence↗
Limited access to a dietary fat option affects ingestive behavior but not body composition in male rats.
Restricting access to high-fat foods is a common strategy utilized to promote health. This strategy may contribute to episodes of overconsumption, however, when the restricted foods subsequently become available. The present study utilized a rat feeding procedure to determine if restricting access to an optional source of dietary fat would increase later consumption of that food under nonenergy-deprived conditions. Five groups of male Sprague-Dawley rats were used, all of which had continuous access to a standard rodent diet and water. The control group had no access to shortening. The low-restriction group had 2-h access to shortening every day. The high-restriction group had 2-h access to shortening on Monday, Wednesday, and Friday. Two additional groups were switched between the high and low conditions. Two-hour and 24-h food intakes were measured every day for 6 weeks. At the end of the study rats were sacrificed and carcass composition determined. As access to the shortening decreased, consumption during the 2-h access period increased. Rats compensated for the increased shortening consumption by decreasing intake of the standard diet. Thus, cumulative energy consumption did not differ among the groups. When switched between the high and low conditions, rats rapidly adjusted to the change in shortening availability. There were no effects of access schedule on carcass composition. These results indicate that restricting access to an optional high-fat food, even under nonenergy-deprived conditions, can promote significant increases in the consumption of that food when it subsequently becomes available.
Analysis of Variance↗
Role of REM sleep and dream variables in the prediction of remission from depression.
To test the hypothesis that REM sleep and/or dreams contribute to overnight mood regulation, 61 subjects were tested on the Beck Depression Inventory (BDI), and for 3 nights of monitored sleep on two occasions, once close to, and 1 year after, a marital separation. Forty-nine percent of the variance in the follow-up BDI could be accounted for by the initial BDI score, and three sleep and dream variables associated with the mood regulatory hypothesis: eye movement density in the first REM, strength of the affect in the first dream and total number of negative dreams recalled from REM awakenings. Among the 39 who met BDI depression criteria initially, 71.8% could be classified correctly as remitted or not remitted at follow-up by discriminant function analysis based on the presence of negative dreams the first vs. second half of the night. Subjects reporting more negative dreams at the beginning and fewer at the night's end were more likely to be in remission 1 year later than were those with fewer negative dreams at the beginning and more at the end of the night. Early negative dreams may reflect a within-sleep mood regulation process taking place, while those that occur later may indicate a failure in the completion of this process.
Adult↗
Molecular dynamics simulations of an oligonucleotide duplex with adenine tracts phased by a full helix turn.
A theoretical model of a DNA oligonucleotide duplex featuring A-tracts phased by a full helix turn is developed based on molecular dynamics computer simulation. The extent to which this model agrees with relevant experimental data on axis bending and the relationship of A-tracts to bending and other aspects of helix morphology is investigated. Specifically, a series of nanosecond-level molecular dynamics (MD) simulations have been carried out for the 25 bp duplex d(ATAGGCAAAAAATAGGCAAAAATGG) at various concentrations of saline solution. A 30 base-pair sequence composed of three 10 bp repeats of the BamHI recognition sequence ligated together, d(CGGGATCCCG. CGGGATCCCG.CGGGATCCCG), was simulated as a control. The MD was carried out using the AMBER 4.1 suite of programs, and utilized the Cornell et al. force-field with the electrostatic boundary conditions treated by the particle-mesh Ewald summation protocol. The MD results show that at a concentration of 60 mM KCl, 10 mM MgCl2 added salt plus minimal neutralizing cations, the MD model exhibits concerted axis bending to the extent of 15.5 degrees per A-tract. This compares favorably with the bending per turn of 17 to 21 degrees inferred from cyclization experiments. The MD model also exhibits a progressive 5' to 3' narrowing of the minor-groove region of A-tracts, a feature inferred from DNA footprinting experiments. Analysis of the dynamic structure of the MD models shows that the origin of the bending follows a junction-type bending model with an admixture of mixed sequence effects, with A-tracts relatively straight, as in oligonucleotide crystal structures of sequences containing A-tracts. The results are shown to be sensitive to environmental conditions: MD on d(ATAGGCAAAAAATAGGCAAAAATGG) in neutralizing Na+ buffer results in markedly reduced curvature, and the removal of Mg2+ measurably affects bending. Carrying out the simulations at experimental salt conditions appears to be essential to obtain an accurate account of the experimentally observed bending.
Adenine↗
Bright light treatment of winter depression: a placebo-controlled trial.
BACKGROUND: Bright light therapy is the recommended treatment for winter seasonal affective disorder (SAD). However, the studies with the best placebo controls have not been able to demonstrate that light treatment has a benefit beyond its placebo effect. METHODS: Ninety-six patients with SAD completed the study. Patients were randomly assigned to 1 of 3 treatments for 4 weeks, each 1.5 hours per day: morning light (average start time about 6 AM), evening light (average start about 9 PM), or morning placebo (average start about 6 AM). The bright light (approximately 6000 lux) was produced by light boxes, and the placebos were sham negative-ion generators. Depression ratings using the Structured Interview Guide for the Hamilton Depression Rating Scale, SAD version (SIGH-SAD) were performed weekly. RESULTS: There were no differences among the 3 groups in expectation ratings or mean depression scores after 4 weeks of treatment. However, strict response criteria revealed statistically significant differences; after 3 weeks of treatment morning light produced more of the complete or almost complete remissions than placebo. By 1 criterion (24-item SIGH-SAD score <50% of baseline and < or =8), 61% of the patients responded to morning light, 50% to evening light, and 32% to placebo after 4 weeks of treatment. CONCLUSIONS: Bright light therapy had a specific antidepressant effect beyond its placebo effect, but it took at least 3 weeks for a significant effect to develop. The benefit of light over placebo was in producing more of the full remissions.
Adult↗
Reproducibility and comparability of insulin sensitivity indices measured by stable-label intravenous glucose tolerance test.
We have investigated the reproducibility of (1) insulin sensitivity (S*I) and glucose effectiveness (S*G) as measured by the stable-label (one compartment) minimal model, and (2) insulin sensitivity (S*Ib), plasma clearance rate (PCR), basal hepatic output (HGOb), and total hepatic glucose output (HGO0-240) as measured by the novel stable-label two compartment model of glucose disappearance during labelled intravenous glucose tolerance test (IVGTT) using 6,6-(2)H-glucose. Ten normal male subjects were studied on two occasions one week apart. Both models provided estimates of all indices with acceptable precision (CV of parameter estimates < or =50%). The within subject CVs of S*I and S*Ib were comparable (17% vs 19%) as were the within subject CVs of S*G and PCR (13% vs 16%). A highly significant linear relationship was observed between S*Ib and S*I (0.303 +/- 0.046 ml kg(-1) min(-1) per mU l(-1) vs 13.04 +/- 1.89 10(-4) min(-1) per mU l(-1), y = 0.0037 x + 0.0002, r = 0.90, p < 0.001; mean +/- SE), but not between PCR and S*G (1.98 +/- 0.15 ml kg(-1) min(-1) vs 0.0089 +/- 0.0005 min(-1), rs = 0.34, NS). The two compartment model provided a plausible time-profile of hepatic glucose output during IVGTT, reproducible estimates of HGOb (1.96 +/- 0.18 mg kg(-1) min(-1), 15%; mean +/- SE, within subject CV), and a highly reproducible HGO0-240 (7%; within subject CV). We conclude that the stable-label (one compartment) minimal model and the stable-label two compartment model provide reproducible estimates of parameters of glucose kinetics in normal subjects. Insulin sensitivity indices estimated by the two models are strongly linearly related.
Adult↗
Measuring pre-hepatic insulin secretion using a population model of C-peptide kinetics: accuracy and required sampling schedule.
The accuracy of calculations of pre-hepatic insulin secretion were investigated, to provide independent validation of a population model of C-peptide kinetics. The effects of sampling frequency were also assessed. Five normal subjects (aged 28 to 43 years; BMI (kg/m2) 20.5 to 24.5) and five subjects with non-insulin-dependent diabetes mellitus (NIDDM) treated by diet alone (aged 34 to 57 years; BMI 22.6 to 25.6) were given a variable intravenous infusion of biosynthetic human C-peptide (BHCP) (t=-60 to 240 min) mimicking meal stimulated C-peptide secretion, with short-term oscillations (peak approximately every 12 min) superimposed on the infusion profile. Plasma C-peptide was measured every 5 min (t=0 to 240 min). The BHCP infusion was reconstructed from C-peptide measurements using a population model of C-peptide kinetics and a deconvolution method. Bias, defined as the percentage difference between the total amount of calculated BHCP and the total amount of infused BHCP (t=0 to 240 min), indicated that overall C-peptide secretion can be measured with 14% [95% confidence interval (CI) -11 to 39%] and 21% (95% CI -3 to 45%) accuracy in normal subjects and subjects with NIDDM respectively. Accuracy was not reduced by reducing the sampling frequency to every 30 min. The root mean square error, measuring the average deviation between the infused and normalised calculated BHCP profiles, was also independent of the sampling frequency [mean (95% CI) 0.9 (0.3 to 1.6) pmol/kg per min in normal subjects; 1.0 (0.9 to 1.1) pmol/kg per min in subjects with NIDDM]. Deconvolution employing a population model of C-peptide kinetics can be used to estimate postprandial total C-peptide secretion with biases of 14% and 22% respectively in normal subjects and subjects with NIDDM. Plasma C-peptide samples need only be drawn every 30 minutes.
Adult↗
Pharmacokinetics of troglitazone, a PPAR-gamma agonist, in patients with hepatic insufficiency.
OBJECTIVE: Troglitazone is an agonist of the peroxisome proliferator-activated receptor-gamma (PPAR-gamma), which has been shown to improve the metabolic control of type 2 diabetes. Troglitazone undergoes hepatic metabolism to an inactive sulphate conjugate and an oxidative quinone metabolite with minor activity. The objective of this study was to compare the pharmacokinetics of troglitazone in patients with hepatic insufficiency and normal subjects. METHODS: Three groups of eight subjects with normal liver function and moderate or severe hepatic impairment (Pugh-Child classification) completed this open study. Subjects received a single 400-mg dose of troglitazone 30 min after breakfast. Plasma concentrations of troglitazone and its metabolites were measured and standard pharmacokinetic parameters derived. RESULTS: A 46% increase in area under the plasma concentration-time curve (AUClast) was observed for troglitazone, together with a 154% increase for the quinone metabolite in the patients with moderate hepatic impairment compared with normal subjects, but these did not reach statistical significance. Corresponding increases of 18% and 53% in the severe group also failed to reach statistical significance. For the sulphate conjugate, the AUClast values for both moderate and severe hepatic impairment were in the order of fourfold higher than those in the normal group. There were reductions in the maximum observed plasma concentration (Cmax) of troglitazone to 61% of the normal group in the severe group for troglitazone, and twofold increases in sulphate metabolite Cmax in the moderate and severe groups. There was an approximately threefold increase in the half-life of the sulphate conjugate in subjects with both moderate and severe impairment of liver function compared with normal individuals. First times to maximum concentrations of troglitazone, its sulphate conjugate and the quinone metabolite were significantly longer in all severely impaired subjects compared with those with normal hepatic function, although the range was wide in all cases. Plasma protein binding was high in all subjects measured (mean unbound fraction range 0.7-5.1%), but there were insufficient samples to compare across groups. CONCLUSION: The formation of metabolites of troglitazone following a single dose is not impaired in the presence of reduced liver function although the capacity to eliminate the metabolites is altered. The clinical significance of the effect of liver disease on the conjugates is not clear.
Adult↗
Gastrointestinal manifestations of scleroderma.
Gastrointestinal involvement is commonly found in scleroderma. Gastrointestinal symptoms may be the presenting symptoms for the diagnosis and may precede the actual diagnosis by months to years. The esophagus is the most frequently affected, but functional problems of the anorectum, small bowel, colon, and stomach may occur. The pathophysiologic mechanism appears to be one of smooth muscle atrophy and, to a lesser degree, fibrosis. These changes result in gastrointestinal motility disturbances and may cause GERD, pseudo-obstruction, bacterial overgrowth, and defecatory disorders. Malnutrition may be a serious consequence. The evaluation of a particular symptom in a patient with scleroderma may lead to treatment strategies that improve the patient's sense of well-being and quality of life.
Digestive System Diseases↗
Respiratory complications of gastrointestinal diseases.
Further advances in the ability to diagnose GER disease by use of ambulatory pH monitoring have unveiled a host of extraesophageal manifestations of GERD. These include pulmonary symptoms of asthma, recurrent pneumonia, cough or bronchitis, and infant apnea. Many of these symptoms may be the sole presentations of GER in these patients. It is important that the clinician is aware of these atypical presentations of GERD. The expanding use of ambulatory pH monitoring is helping to clarify the underlying pathophysiology of these disorders as well as to improve the ability to diagnose the atypical manifestations of GERD.
Gastroesophageal Reflux↗
Concomitant administration of cholestyramine influences the absorption of troglitazone.
AIM: Troglitazone is an orally active anti-diabetic agent. Cholestyramine is an orally administered lipid-lowering agent which acts by binding to bile acids and removing them from enterohepatic circulation. Preclinical studies suggesting the potential for an interaction between troglitazone and cholestyramine require confirmation in a clinical setting. METHODS: In vitro and in vivo experiments in the dog were carried out prior to a clinical study. Twelve healthy volunteers (mean age 32 years, range 20-44 years) each received a single oral dose of troglitazone 400 mg alone and with cholestyramine 12 g (taken 1 h after troglitazone) in an open, two-way crossover study. RESULTS: In vitro, about 99% of troglitazone was adsorbed by cholestyramine at an incubate concentration of 3 microg ml(-1) whilst at 500 microg ml(-1) adsorption fell to about 90%. In vivo, AUC of troglitazone was reduced by an average of 42% (22.7 vs 12.2 microg ml(-1) h (95% CI for difference 28-57, P=0.01) in 11 beagle dogs receiving troglitazone 200 mg and cholestyramine 1 g compared with control values. Mean maximum plasma concentration (Cmax) was 49% of control values (7.08 vs 3.42 microg ml(-1) (95% CI for difference 14-85, P=0.05)). In the clinical study median AUC for troglitazone and its two major metabolites were statistically significantly lower when troglitazone was administered with cholestyramine (17.9 vs 5.2 microg ml(-1) h (95% CI for difference -20.5, -8.7), 133.7 vs 27 1 microg ml(-1) h (-166.4, -67.8) and 18.4 vs 2.5 microg ml(-1) h (-21.6, -10.6) for troglitazone, sulphate and quinone metabolite respectively (all P < 0.01) representing percentage decreases of 71, 80 and 86% respectively. A statistically significant reduction was also observed in Cmax for the sulphate metabolite (4.56 vs 1.28 microg ml(-1) (95% CI for difference -4.42, -1.99, P < 0.01)), but not for troglitazone (1.85 vs 1.23 microg ml(-1) (-1.13, 0.49) or the oxidative metabolite (0.84 vs 0.45 microg ml(-1) (-0.77, 0.09)). CONCLUSIONS: The results were indicative of an alteration in the extent of troglitazone's absorption. Concomitant administration of troglitazone and cholestyramine could severely impair troglitazone's clinical utility as an antihyperglycaemic agent.
Absorption↗
Improvement in the gastrointestinal absorption of troglitazone when taken with, or shortly after, food.
AIMS: Troglitazone, an insulin action enhancing agent, is currently in clinical development for the treatment of non insulin dependent diabetes mellitus. The objective of this study was to establish the effect of food on the systemic absorption and metabolism of troglitazone. METHODS: After an overnight fast, 12 healthy male volunteers each received, in random order, troglitazone (400 mg orally) alone, concomitantly with (at the start of), and 30 min after, a standardized diabetic breakfast as part of a three-period crossover study. RESULTS: When troglitazone was administered with or after food, geometric mean values of area under the plasma concentration-time curves (AUC[last]) relative to fasting state were increased significantly by 59% in both cases (95% CI 1-150%, P=0.046 and 2-148%, P=0.040) with values of 11.4, 11.5 and 7.2 microg ml(-1) h respectively. Maximum observed plasma concentration (Cmax) increased by 96% and 72% (95% CI 29-197%, P=0.003 and 15-158%, P=0.011) with values of 2.2, 2.0 and 1.1 microg ml(-1) respectively. Changes in t(lag) were not clinically significant. Increases in AUC(0, infinity) for the main circulating sulphate metabolite relative to fasting were also significant (41%, 95% CI 5-89%, P=0.025 and 34%, 95% CI 1-79%, P= 0.044 respectively) with values of 82.6, 78.6 and 58.5 microg h ml(-1). Cmax increased by 68% (95%, CI 10-156%, P=0.019) and 65% (95% CI 9-149%, P=0.020) with values of 3.2, 3.1 and 1.9 microg ml(-1) respectively. Reductions in t1/2 (16 and 21%, 95% CI 0-30, 6-33) although statistically significant (P=0.050 and P=0.009) were not clinically significant with values of 22.3, 20.4 and 24.5 h for with food, after food and fasting respectively. Troglitazone was well tolerated in all cases throughout the study with a trend for improved tolerability of gastrointestinal symptoms when taken 30 min after a meal. CONCLUSIONS: The absorption of troglitazone is enhanced significantly by food with little effect on the main metabolic pathway. Increased absorption of troglitazone in the presence of food is likely to be a consequence of enhanced solubility in bile combined with an increase in dissolution time. On the basis of these findings, troglitazone should be taken either with, or up to 30 min after, food.
Adult↗
Extended confocal microscopy of myocardial laminae and collagen network.
Ventricular myocardium has a complex three-dimensional structure which has previously been inferred from two-dimensional images. We describe a technique for imaging the 3D organization of myocytes in conjunction with the collagen network in extended blocks of myocardium. Rat hearts were fixed with Bouin's solution and perfusion-stained with picrosirius red. Transmural blocks from the left ventricular free wall were embedded in Agar 100 resin and mounted securely in an ultramicrotome chuck. Confocal fluorescence laser scanning microscopy was used to obtain 3D images to a depth of 60 microns in a contiguous mosaic across the surface. Approximately 50 microns was then cut off the surface of the block with an ultramicrotome. This sequence was repeated 20 times. Images were assembled and registered in 3D to form an extended volume 3800 x 800 x 800 microns 3 spanning the heart wall from epicardium to endocardium. Examples are given of how digital reslicing and volume rendering methods can be applied to the resulting dataset to provide quantitative structural information about the 3D organization of myocytes, extracellular collagen matrix and blood vessel network of the heart.
Animals↗
Neurologic complications after coronary artery bypass grafting.
Although outcomes from coronary artery bypass grafting (CABG) surgery have improved in general, there has been little or no improvement in the incidence of postoperative stroke or neurologic dysfunction. Several studies have identified factors that increase the CABG patient's risk for developing a stroke and neurologic complications. It is important to identify those patients at increased risk and differentiate among stroke, delirium, and seizures. Post-CABG patients need to be monitored for neurological dysfunction with appropriate assessments. Neurologic complications must be appropriately managed to optimize patient recovery.
Cerebrovascular Disorders↗
What are you doing to my patient?
Explore the source record for details and available documents.
Adult↗
A physician-owned and -operated behavioral managed care company.
Explore the source record for details and available documents.
Contract Services↗