PubMed Health⌕ Search

Biomedical subjects

M Bar-Eli

Publications and source records attributed to M Bar-Eli.

At least 55 records · Page 3Linked to original sources
PubMed1996

Interleukin 10 suppresses tumor growth and metastasis of human melanoma cells: potential inhibition of angiogenesis.

Interleukin 10 (IL-10) inhibits the production of a wide range of cytokines in various cell types. The purpose of this study was to determine whether the expression of the IL-10 gene can influence tumor growth and metastatic properties of human melanoma cells. The human melanoma cell line, A375P, which does not produce endogenous IL-10, was transfected with a hygromycin expression vector (control) or a vector containing full-length murine IL-10 cDNA. A375P parental cells, A375P-Hygro, and A375P-IL-10-positive cells were injected s.c. and i.v. into nude mice. A375P-IL-10 cells produced significantly slower growing s.c. tumors and fewer lung metastases than control cells. The tumorigenicity of the human melanoma A375SM and the murine melanoma B16-BL6 cells was also significantly inhibited when they were admixed with A375P-IL-10 but not with A375P-Hygro before s. c. injection into nude mice. The suppression of tumor growth and metastasis was directly correlated with a decrease in neovascularity determined by immunostaining with anti-factor VIII. Because tumor-associated macrophages are the major source of angiogenic molecules in melanoma, we used reverse transcription-PCR to demonstrate that IL-10 down-regulates the production of vascular endothelial growth factor, the most potent angiogenic factor in activated macrophages. Other factors involved in angiogenesis such as IL-1beta, tumor necrosis factor-alpha, IL-6, and the proteinase matrix metalloproteinase-9 were also inhibited in activated macrophages by supernatants from A375P-IL-10 cells. Collectively, these data suggest that the production of IL-10 by tumor cells inhibits macrophages-derived angiogenic factors, and hence, tumor growth and metastasis.

Animals↗
PubMed1995

Abnormalities in the CDKN2 (p16INK4/MTS-1) gene in human melanoma cells: relevance to tumor growth and metastasis.

The inhibitor of cyclin-dependent kinase 4, CDKN2 (also known as p16INK4 or MTS-1, multiple tumor suppressor gene 1), has been mapped to 9p21. The gene has been shown to be deleted or mutated in high frequency in human melanoma cell lines and familial melanoma patients, suggesting that it could be a melanoma suppressor gene. How these observations are related to tumorigenicity and metastasis of human melanoma is not clear however. To test the role of CDKN2 in human melanoma metastasis, 14 human melanoma cell lines with different metastatic abilities in nude mice were analysed for possible abnormalities in the CDKN2 gene. Homozygous deletions that resulted in a lack of gene expression were found in six of 14 cell lines tested. SSCP-direct sequencing revealed point mutations in three other cell lines. One cell line displayed CC to TT transitions which constitute a hallmark of ultraviolet-induced DNA damage. Overall, abnormalities in the CDKN2 gene were found in nine of 14 (64%) cell lines tested. Homozygous deletion and lack of gene expression were found in several low tumorigenic and nonmetastatic melanoma lines, whereas other metastatic cells did not exhibit abnormalities in the CDKN2 gene. These data suggest that the absence of normal CDKN2 does not confer growth advantage to melanoma cells in vivo and that the production of metastasis by human melanoma cells can occur in the absence of CDKN2 gene abnormalities.

Animals↗
PubMed1995

Ultraviolet B irradiation promotes tumorigenic and metastatic properties in primary cutaneous melanoma via induction of interleukin 8.

UV radiation has been shown to play a role in the initiation of human cutaneous melanoma, but its role in the development of malignant melanoma to the metastatic state is not very well defined. Although previous studies have concentrated on the effect of UV-B on the host immune response, the effect of UV-B on the tumor cells was not elucidated. Here we show that UV-B can induce interleukin 8 (IL-8) mRNA and protein secretion in human cutaneous melanoma with negligible expression of IL-8. UV-B-induced IL-8 was constitutively expressed 60 days after irradiation in tumors implanted in mice. Induction of IL-8 was UV-B dose dependent and blocked by cyclohexamide, indicating that de novo protein synthesis is required for its expression. The UV-irradiated cells demonstrated enhanced tumorigenicity and metastatic potential in nude mice. The increase in tumorigenicity and metastatic ability could be explained by the increase in Mr 72,000 type IV collagenase activity and angiogenesis attributed to the induction of IL-8 after irradiation. The acquisition of the metastatic phenotype induced by UV-B could not be attributed to abnormalities in the p53 or MTS-1 (p16INK4) genes. To the best of our knowledge, this is the first report to show that UV-B can increase the aggressiveness of human cutaneous melanoma for growth and metastasis.

Animals↗
PubMed1995

Regulation of mental states and biofeedback techniques: effects on breathing pattern.

The purpose of the present study was to examine whether breathing pattern may be used as a reliable index for the effectiveness of techniques applied for the regulation of mental states. Heart rate (HR), breathing pattern, galvanic skin response (GSR), and electromyogram (EMG) of the frontalis muscle were measured in 39 male and female subjects aged 18-25 years during 10-minute treatment with relaxation technique (autogenic training and/or music) followed by 10 minutes of imagery training. In the first 7 sessions biofeedback (BFB) was not included, while during the last 6 sessions BFB was introduced and utilized by the subjects. Relaxation (music or autogenic training) led to a decrease in breathing frequency, attributed to lengthening of expiration time, as well as reduced HR, GSR, and frontalis EMG response. In most instances imagery training was related to an increase in these indices. Specifically, significant tachypnea was observed during imagery of sprint running. In most cases BFB substantially augmented the physiological responses. In conclusion, our data suggest that, compared with HR, GSR, and EMG responses, the breathing pattern is at least as sensitive to the mental techniques employed, and may be useful as a psychophysiological index for diagnosis and testing, especially in sport practice.

Adult↗
PubMed1995

The augmenting role of biofeedback: effects of autogenic, imagery and music training on physiological indices and athletic performance.

In this study, three psychoregulative procedures of relaxation and excitation were provided in combination with biofeedback to examine their role on physiological and athletic performance variables. Thirty-nine college students were randomly assigned to three groups of psychoregulatory treatment (autogenic and imagery training, AT+IT; music and imagery training, M+IT; autogenic, music and imagery training, AT+M+IT), one placebo group and the control group. Imagery was related to a 100-m run. The treatment and control conditions lasted 13 sessions of 20 min each. During the first seven sessions, the subjects in the treatment groups underwent 10 min of relaxation followed by 10 min of excitation. During the last six sessions, similar treatment was provided accompanied by frontalis EMG biofeedback. Heart rate, the galvanic skin response, EMG and breathing frequency (fb) were recorded three times during each session. In addition, an athletic task (100-m run) was examined at the outset, after seven sessions (no biofeedback) and after an additional six sessions (with biofeedback). Biofeedback was found to have a significant augmenting effect on physiological components and athletic performance when accompanied by autogenic, imagery and music training. Soft music was found to be as beneficial as other relaxation techniques. The results are compared with similar studies applying mental techniques with biofeedback, and new directions of investigation in the psychophysiological domain are suggested.

Adolescent↗
PubMed1995

Wild-type p53 regulates its own transcription in a cell-type specific manner.

Wild-type (w.t.) p53 acts as a transcriptional regulator that binds to DNA and modulates transcription of several promoters. Wild-type p53 has also been shown to autoregulate its own transcription. There is no agreement, however, on whether w.t. p53 has trans-activates or downregulates its own transcription. To further explore the transcriptional autoregulation of the p53 gene, we analyzed the effect of w.t. p53 on its own promoter in different cell lines that do not express p53. A DNA domain within the human p53 promoter (-48 to -23) with the structure of ATGGGATTGGGGTTTTCCCCTCCCAT shares 8 of 10 nucleotides sequence homology with the p53 binding motif. When the human p53 promoter that included this domain was linked to a chloramphenicol acetyltransferase (CAT) gene and coexpressed with w.t. or mutated p53 in cells lacking p53 protein, w.t. p53 down-regulated its own promoter in SAOS-2 and K562 cells, but not in DP15 cells. We were unable to detect direct interaction of p53 with its promoter or to domain -48 to -23 following transfection of these cells with w.t. p53. A different pattern of protein--DNA complexes was observed, however, between the p53 promoter and nuclear extracts from SAOS-2 and DP15 cells following transfection with w.t. p53. These data suggest that w.t. p53 autoregulates its own promoter indirectly and in a cell type-specific manner.

Amino Acid Sequence↗
PubMed1995

Suppression of tumor growth and metastasis of murine renal adenocarcinoma by syngeneic fibroblasts genetically engineered to secrete the JE/MCP-1 cytokine.

The murine monocyte chemoattractant protein 1, JE/MCP-1, like its human counterpart monocyte chemotactic and activating factor (MCAF), attracts monocytes-macrophages to tumor tissues. In previous studies we reported that expression of the JE/MCP-1 gene in murine colon carcinoma cells reduced their tumorigenicity and suppressed their metastatic potential. We now demonstrate that the growth and metastasis of the renal adenocarcinoma cell line RENCA are reduced when it was admixed with syngeneic fibroblasts engineered to secrete the JE/MCP-1 cytokine before injection. Culture supernatants of JE/MCP-1-expressing cells plus lipopolysaccharide (LPS) synergistically activated tumoricidal properties in syngeneic macrophages against RENCA cells. This activity was blocked by anti-JE/MCP-1 antibody, indicating that JE/MCP-1 was involved in priming the macrophages to respond to LPS. Moreover, alveolar macrophages isolated shortly after iv injections of JE/MCP-1 transfected cells were cytotoxic to RENCA cells in vitro. Collectively, these data suggest that in addition to its chemotactic properties, JE/MCP-1 can synergize with bacterial endotoxins to activate macrophages, thus providing a rationale for the use of the JE/MCP-1 protein as a modality for treatment of metastasis.

3T3 Cells↗
PubMed1995

The psycho-physiological response to parachuting among novice and experienced parachutists.

Elevated heart rate and increased anxiety are two indicators of stress. This study investigated the heart rate and anxiety response to parachuting among seven novice and six experienced parachutists. Heart rate was measured from the moment of boarding the aircraft until landing. Anxiety was measured prior to boarding the aircraft. Heart rate was significantly higher among the novice compared to the experienced parachutists, especially during takeoff (125 +/- 11 vs. 95 +/- 17 beats.min-1, respectively), and upon exit or free fall (184 +/- 12 vs. 164 +/- 17 beats.min-1, respectively). However, due to the difference in ages between the groups, when expressed relative to maximal heart rate, there was no difference in the heart rate response between groups (e.g., exit/free fall: 93.0 +/- 5.5% vs. 88.4 +/- 7.8% for novice and experienced, respectively). No statistical differences were observed in the anxiety scores between groups, although the novice parachutists scored somewhat higher (16.0 +/- 3.7 vs. 12.5 +/- 5.7, respectively). A significant correlation (r = 0.72) was observed between heart rate upon landing and the state anxiety scores. These results demonstrate a high psycho-physiological stress response to parachuting among both novice and experienced parachutists. It is likely that novice parachutists are stressed to a higher degree and may therefore be more prone to performance-related injury (e.g., upon landing). However, since both groups reached a similar percentage of their maximal heart rate, they may be at a similar risk of cardiac injury.

Adult↗
PubMed1994

Expression of the JE/MCP-1 gene suppresses metastatic potential in murine colon carcinoma cells.

The purpose of this study was to determine whether the expression of the JE/MCP-1 gene encoding for the monocyte chemottractant protein, MCP-1 (also known as monocyte chemotactic and activating factor MCAF, TDCF, and SMC-CF) can influence the metastatic properties of tumor cells. The highly metastatic murine colon carcinoma CT-26 cells, syngeneic to BALB/c mice that do not produce endogenous JE/MCP-1 protein, were transfected with a BCMGS-Neo expression vector (control) or a vector containing full-length JE cDNA. CT-26 parental cells, CT-26 Neo, and CT-26 JE/MCP-1-positive cells were injected into syngeneic or nude mice. The CT-26 JE/MCP-1-positive cells produced significantly fewer lung metastases. The decrease in incidence of metastasis was not due to the inability of the transfected cells to arrest in the lung vasculature or to differences in cell cycle time. CT-26 cells producing JE/MCP-1 were highly susceptible to lysis by syngeneic macrophages treated with subthreshold concentrations of lipopolysaccharide. In addition, culture supernatants of JE/MCP-1-expressing cells plus lipopolysaccharide synergistically activated tumoricidal properties in syngeneic macrophages. This activity was blocked by anti-JE/MCP-1 antibodies, indicating the involvement of the JE/MCP-1 molecule in this process. Moreover, purified JE/MCP-1 added to lipopolysaccharide-containing medium resulted in significant activation of macrophages against parental CT-26 cells. These data suggest that, in addition to its chemotactic properties, JE/MCP-1 can synergize with bacterial endotoxins to activate macrophages to become tumoricidal and, hence, could suppress metastasis.

Adenocarcinoma↗
PubMed1994

Delivery of interferon to intracellular pathways by encapsulation of interferon into multilamellar liposomes is independent of the status of interferon receptors.

The antiproliferative effect of interferon alpha (IFN-alpha) against cultured 253J human bladder tumour cells was enhanced when IFN-alpha was encapsulated into multilamellar phospholipid liposomes (MLV). Moreover, significant cytostasis of a variant 253J subline (253J alpha R, resistant to the antiproliferative effect of IFN-alpha), could be achieved by delivery of IFN-alpha contained in liposomes. Although the two cell lines have the same number and affinity of cell receptors for IFN-alpha, the 253J alpha R cells did not down-regulate receptors as observed for the IFN-sensitive 253J cells. The IFN-response genes, 2'-5' oligosynthetase and gene 6-16 were equally induced in both cell lines following incubation of the cells with either free IFN-alpha or liposome-encapsulated IFN-alpha. Incorporation of radiolabelled IFN-alpha into cells by liposomes was independent of the status of IFN-receptors (the receptors being either occupied or down-regulated). These observations are consistent with the hypothesis that the antiproliferative effects of IFN-alpha against 253J and 253J alpha R cells may be mediated by internalization of IFN-alpha.

2',5'-Oligoadenylate Synthetase↗
PubMed1994

Information recall of younger and older skilled athletes: the role of display complexity, attentional resources and visual exposure duration.

This study was concerned with the interactive role of experience of athletic skill with other relevant environmental variables (display complexity, attentional resources, exposure time of stimuli) on perception (recall) of structured handball game situations. Nineteen experienced (older) and 19 less experienced (younger) handball players were assigned randomly either to ball-bouncing (diverted attention) or to calm seated (focused attention) conditions. In each of the two conditions, the subjects were exposed to a total of 36 slides containing 2-3, 5-6 and 8-10 players. Eighteen slides were exposed for 0.5 s and 18 for 1.0 s. All the slides contained structured defence and offence situations. Recall scores were subjected to repeated-measures ANOVA using attention condition and age as between-subject factors and task complexity and exposure duration as within-subject factors. The results showed that the recall of less experienced players deteriorated more than the recall of more experienced players following exposure to complex displays (> or = 8 players) while engaging in a secondary task (bouncing). The findings suggest that research paradigms should be applied in the field of sport which share both ecological validity and a potential to discover the cognitive substrates underlying experience and age in skilled motor performance.

Adolescent↗
PubMed1994

Terminal differentiation and apoptosis in experimental lung metastases of human osteogenic sarcoma cells by wild type p53.

Human SAOS-2 osteogenic sarcoma cells are not metastatic in nude mice and do not express p53. We have selected a variant line (SAOS-LM2) that is tumorigenic and metastatic in nude mice. These cells were transfected with the p53 wild-type (p53wt) or mutated (p53mut 143A) gene, whose expression was verified by reverse transcriptase PCR, cDNA sequencing, and protein immunoprecipitation. Cells were injected i.v. into nude mice, and 4 months later, the mice were necropsied. All cell lines produced a similar number of visible lung metastases, albeit of different sizes. Microscopic examination revealed that most lung metastases in mice injected with p53wt cells (but not p53mut 143A or control cells) consisted of osteoid matrix and apoptotic cells. Expression of either p53wt or p53mut 143A verified the origin of the metastases. These data suggest that transfection of SAOS-LM2 cells with p53wt is associated with in vivo induction of terminal differentiation and apoptosis that inhibit progressive growth of metastases.

Animals↗
PubMed1993

Direct correlation between MUC18 expression and metastatic potential of human melanoma cells.

The expression of the glycoprotein MUC18 in melanoma biopsies has previously been shown to increase with increasing tumour thickness, and thus to correlate with the probability of metastasis development. We have examined the expression of this molecule by nine human melanoma cell lines with known metastatic ability (both spontaneous and experimental) in nude mice. Examination of the expression of both the MUC18 mRNA and of the glycoprotein on the cell surface revealed a statistically significant correlation (P = 0.040) between its expression and the ability to form metastases in vivo. Although MUC18 shows sequence similarity to neural cell adhesion molecules, no correlation was observed between the site of origin of the metastatic lesions (brain, lymph node) and MUC18 expression.

Animals↗
PubMed1993

The relationship between cognitive characteristics and decision making.

Team handball players (N = 118) underwent a number of cognitive tests to examine how much of their decision making (DM) ability, as measured through responses to game slides projected to them for 2 seconds under low and high exertion levels (i.e., walking and running), was accounted for by cognitive components. A stepwise multiple linear regression indicated that experience was the most pronounced predictor of DM capacity in both exertion conditions. In the walking condition, concentrational consistency, avoidance of concentrational mistakes, and short-term memory, together with experience, produced a multiple R of 0.48 with decision making. In the running condition, choice reaction time (CRT), intelligence, and short-term memory, together with experience, correlated 0.46 with DM. These differences in cognitive abilities, as predictors of DM under walking and running conditions, are discussed in terms of information processing models and other cognitive processes.

Attention↗
PubMed1992

Evidence for a structurally homologous Rh-like polypeptide in Rhnull erythrocytes.

Human Rhnull red blood cells fail to react with Rh antibodies, indicating that these cells are either devoid of Rh protein or, like other species, possess antigenically distinct variants. To determine whether Rhnull cells possess an Rh-like polypeptide, 32-kDa proteins from D--, rr, and Rhnull cells were labeled with the cysteine-specific probe, 125I-labeled pyridyldithioethylamine. Size comparisons of labeled proteins in Triton X-100-solubilized membranes from Rh-bearing and Rhnull cells showed similar sedimentation coefficients and Stoke's radii. Immunoprecipitated Rh(D) from D-- cells, Rh(c) from rr cells, and purified 32-kDa proteins from Rhnull cells were digested with alpha-chymotrypsin and examined by high-performance liquid chromatography and by two-dimensional iodopeptide mapping. Analysis of 125I-labeled chymotryptic fragments from immunoprecipitated Rh(D) and Rh(c) showed the labeled peptides from both phenotypes to be virtually identical. High-performance liquid chromatography profiles and iodopeptide maps of 32-kDa Rhnull proteins yielded patterns identical to 32-kDa proteins isolated from D-- cells and rr cells with the exception of one missing 125I-labeled peptide. Further analysis of the Rh-related fragments from Rhnull cells showed significant homology with immunoprecipitated Rh(D) and Rh(c). DNA sequence analysis of cysteine-encoding regions from Rh-bearing and Rhnull cells showed complete identity. These data suggest that Rhnull red blood cells, although serologically distinct, possess an Rh-like protein that is structurally very similar to Rh(D) and Rh(c).

Amino Acid Sequence↗
PubMed1992

A crisis related analysis of perceived spectators' behavior in competition.

Spectator behavior in competition is analyzed in terms of spectators' response (positive or negative), or lack of response in reaction to a player's action, or which is independent of a player's action, in a home or away game. This study investigated the perceived contribution of these variables to extreme psychological arousal states (crisis, noncrisis). Forty-eight elite ball-game players responded to a questionnaire asking them to estimate the occurrence probability of the Bayesian combinations among these variables under crisis and noncrisis conditions. An RM-ANOVA procedure revealed that under the crisis condition a negative response, an unsuccessful action, and a home game were rated as more probable, whereas under the noncrisis condition the reverse would be true. The athlete's psychological state was more strongly related to spectator response than to game location or athlete's action. Results are discussed theoretically in reference to the crisis construct.

Arousal↗
PubMed1991

Abnormalities of the retinoblastoma gene in the pathogenesis of acute leukemia.

The retinoblastoma-susceptibility (Rb) gene is an antioncogene that is frequently altered in retinoblastomas, sarcomas, and some epithelial tumors. We examined the structure of the Rb gene by Southern blotting in 215 cases of leukemias and lymphomas of diverse phenotype and in 15 leukemic cell lines. In selected cases Rb protein expression was examined with specific monoclonal antibodies. Structural abnormalities of the Rb gene with absent protein expression were frequent in all types of human acute leukemia, but were particularly common (27% incidence) in M4 and M5 myeloid leukemia with monocytic differentiation and in Philadelphia chromosome (Ph1)-positive leukemia of lymphoid phenotype (11% to 29% incidence). Changes in Rb were observed early in the transition to acute leukemia in cases of myelodysplastic syndrome and in the accelerated phase of chronic myelocytic leukemia in transition to blast crisis. In one case, molecular changes in Rb could be correlated with leukemia remission and relapse. We conclude that the Rb antioncogene is commonly involved in the evolution of human acute leukemias, particularly in those of a monocytic phenotype and in lymphoid leukemia in which there is an antecedent alteration of the Ph1 chromosome.

Acute Disease↗