PubMed Health⌕ Search

Biomedical subjects

M D Cave

Publications and source records attributed to M D Cave.

At least 73 records · Page 4Linked to original sources
PubMed1991

IS6110: conservation of sequence in the Mycobacterium tuberculosis complex and its utilization in DNA fingerprinting.

Multiple copies of an insertion sequence, IS6110, were shown to be present in the genome of members of the Mycobacterium tuberculosis complex (M. tuberculosis and M. bovis). Ten to 12 copies are present in various strains of M. tuberculosis, while strains of M. bovis contain only one to three copies. IS6110 was not detected in the DNA of other species of mycobacteria. Restriction endonuclease analysis indicated that the sequence of IS6110 is conserved across strain and species lines. Hybridization to the insertion sequence can be used to detect restriction fragment length polymorphism reflecting divergence in the sequence of regions flanking the various copies of IS6110. These differences were used to fingerprint various strains of the M. tuberculosis complex.

Autoradiography↗
PubMed1991

Chromosomal DNA fingerprint patterns produced with IS6110 as strain-specific markers for epidemiologic study of tuberculosis.

Mycobacterium tuberculosis isolates were studied by comparing chromosomal DNA fingerprint patterns produced by digestion of chromosomal DNA with BamHI, followed by agarose electrophoresis and hybridization with radiolabeled probes of insertion sequence IS6110. DNA fingerprints of 14 isolates from separate members of five households or closely associated individuals were compared. Marked differences were observed when unrelated isolates were compared. There were no or minimal differences in the restriction fragment patterns generated from isolates of any one household or associated group. Among related isolates, the only noticeable difference was an additional fragment of IS6110 in the fingerprint pattern of one isolate. Insertional activity was also suggested when restriction fragment patterns of H37Rv DNA isolated in 1987 and 1990 were compared. In a similar manner, M. tuberculosis reference strain Erdman was compared to a clinical isolate from an individual working with that strain. These isolates had identical DNA fingerprints which were distinct from all other isolates, verifying laboratory-acquired infection. Chromosomal DNA fingerprint patterns produced with IS6110 are excellent stain-specific markers for the epidemiologic study of tuberculosis.

DNA Fingerprinting↗
PubMed1991

Detection of Mycobacterium tuberculosis in sputum samples using a polymerase chain reaction.

A polymerase chain reaction (PCR) assay for the rapid detection of Mycobacterium tuberculosis in sputum samples is described. The target DNA is a 123-base pair (bp) segment of IS6110, which is repeated in the M. tuberculosis chromosome and is specific for the M. tuberculosis complex. Methodology used to lyse the mycobacteria, extract the DNA, and amplify the 123-bp target DNA is presented. The amplified PCR product is detected by examination of ethidium-bromide-stained acrylamide gels. An internal control using the same primers as the target DNA has been constructed to assess the efficacy of each individual reaction. Of 162 sputum samples tested, 82 were smear-positive for acid-fast bacilli. Of the 94 specimens from patients in whom pulmonary tuberculosis was diagnosed, 51 were culture-positive, smear-positive, or both. Fifty of these were PCR positive. Of the 42 specimens from patients with nontuberculous mycobacterial pulmonary disease, 41 were PCR negative. All 26 specimens from patients without mycobacterial infection were PCR negative. This assay provides a sensitive and specific means for the laboratory diagnosis of tuberculosis within 48 h that is relatively simple to perform.

DNA, Bacterial↗
PubMed1990

Polymerase chain reaction amplification of a repetitive DNA sequence specific for Mycobacterium tuberculosis.

A segment of DNA repeated in the chromosome of Mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (PCR). The sequences of the primers (5' to 3') were CCTGCGAGCGTAGGCGTCGG and CTCGTCCAGCGCCGCTTCGG, and a temperature of 68 degrees C was used for annealing the primers in the reaction. Amplification produced a 123-base-pair fragment with an internal SalI site. The specific PCR product was obtained with input DNA from 11 different strains of M. tuberculosis and Mycobacterium bovis and one strain of Mycobacterium simiae. No product was detected with DNA from 28 strains of the Mycobacterium avium complex, Mycobacterium scrofulaceum, Mycobacterium kansasii, Mycobacterium fortuitum, Mycobacterium chelonei, and Mycobacterium gordonae. The PCR product was detected by gel electrophoresis after 30 cycles using 1 fg of input DNA. Amplification of this sequence may provide the basis for an assay to detect M. tuberculosis directly in clinical material.

Base Sequence↗
PubMed1987

The ribosomal DNA transcription unit of the house cricket, Acheta domesticus.

A composite map representing a single ribosomal DNA repeat unit of the house cricket, Acheta domesticus, was constructed from overlapping cloned fragments. Sites in the repeat unit for nine restriction enzymes were mapped. R-loop mapping of sequences coding for 18 S and 28 S RNA demonstrates that the 58-kb ribosomal DNA repeat unit contains a novel-sized internal transcribed spacer of 8.4 kb. The existence of this large spacer was confirmed in genomic DNA, most if not all of the genomic repeat units containing such a spacer. A 15- to 17-kb ribosomal RNA precursor transcript is synthesized as predicted on the basis of the size of the internal transcribed spacer. The 5.8 S RNA gene is localized to a 1-kb sequence immediately 5' to the 28 S gene. The coding regions examined contain no intervening sequences analogous to those described within ribosomal DNA of other eukaryotes. Only 11% of the repeat unit codes for mature ribosomal RNA, while the remainder is nontranscribed (71%) and transcribed (18%) spacer DNA.

Animals↗
PubMed1987

Nucleotide sequence of two repeating units of the 5S rRNA gene from the house cricket Acheta domesticus.

The 5S rRNA genes of the house cricket, Acheta domesticus, are contained within two basic repeating units measuring 3.0 and 2.1 kb, that have been cloned. Nucleotide sequence analysis was done on a 528-bp and a 541-bp EcoRI-HinfI DNA fragment from each cloned repeating unit which contains the 5S rRNA coding region. The nucleotide sequences of the 5S rRNA coding region from the two repeating units are identical.

Animals↗
PubMed1986

Analysis of a large nontranscribed spacer in the ribosomal DNA of the house cricket, Acheta domesticus (Orthoptera:Gryllidae).

An analysis of a 29-kilobase nontranscribed spacer fragment in the ribosomal DNA (rDNA) of the house cricket, Acheta domesticus, revealed a highly repetitious structure. A total of eight EcoRI repeats of three different size classes measuring 259, 420, and 508 base pairs (bp) was mapped to a region 2 kilobases (kb) from the 18 S coding region. The repeats were oriented in a nonrandom manner and had sequences homologous to DNA located immediately adjacent to the repetitive array. DNA sequence analysis showed that the repetitive region was composed of smaller direct repeats 66, 67, and 383 bp in length. There was minor length heterogeneity of the chromosomal restriction fragments containing the entire array, indicating that a variable number of EcoRI repeats is a minor contributor to the total repeat-unit length heterogeneity. Immediately upstream from the EcoRI array there is a 17-kb region composed of 50 to 60 subrepeat elements recognized by a variety of restriction endonucleases. A subcloned SmaI repeat from the array was not homologous to any other part of the rDNA repeat unit or other chromosomal DNA. There was little length heterogeneity in restriction fragments containing the chromosomal 17-kb repetitions region. Immediately upstream from the 17-Kb region there is a 4.1-kb segment with sequences homologous to the EcoRI repeats.

Animals↗
PubMed1985

Analysis of genes for 5S rRNA from the cricket, Acheta domesticus: two classes of repeating units.

To examine the modulation of 5S rRNA gene activity during development in the cricket, Acheta domesticus, 5S X DNA was isolated from a lambda Charon 4 genomic library and characterized. Southern blot analysis of cloned A. domesticus genomic DNA revealed that restriction fragments of 3.0 and 2.1 kb represent two size classes of 5S X DNA repeating units; over 90% of the repeats measure 3.0 kb. Restriction analysis of two 5S X DNA clones suggests that the 2.1-kb repeats are not randomly interspersed within clusters of the larger 3.0-kb repeating units. Heteroduplex and restriction mapping of several clones indicate that the spacers of both repeating units account for their unusual length. The major difference between the two classes of repeats may lie in 0.9-kb spacer sequences to the 3.0-kb repeats.

Animals↗
PubMed1981

Evidence for plasmid-mediated restriction-modification in Mycobacterium avium intracellulare.

Mycobacterium avium intracellulare strain LR25 carries three plasmids with molecular weights of 11.2, 18.3 and 107 X 10(6) as determined by electron microscopy. A number of phages propagated on Mycobacterium smegmatis ATCC 607 were tested for their ability to infect strain LR25. Phage JF2 gave an efficiency of plating of 10(-4) on strain LR25, but phage JF2 propagated on strain LR25 infected strain LR25 and M. smegmatis with equal high efficiency. This indicated the presence of a restriction-modification (R-M) system in strain LR25 that was not present in M. smegmatis. Strain LR25 was grown in the presence of acriflavine to eliminate the plasmids and tested for sensitivity to phage JF2. One of forty colonies was found to be R-M-deficient. This strain, designated strain LR163, lacks the three plasmids present in strain LR25. The results indicate that the R-M system is plasmid-coded. Strain LR163 was sensitive to several phages to which strain LR25 was resistant and for which we were unable to isolate modified phage. This suggests that some plasmid-coded function in addition to restriction is involved. An R-M system was also demonstrated in M. avium intracellulare strain LR131 using phage JF1. This strain does not carry plasmids.

Bacteriophage Typing↗
PubMed1980

Comparative induction of unscheduled DNA synthesis by physical and chemical agents in non-proliferating primary cultures of rat hepatocytes.

The incorporation of [3H]thymidine into DNA due to unscheduled DNA synthesis (UDS) induced by N-OH-2-acetylaminofluorene (N-OH-AAF), aflatoxin B1 (AFB1), ethyl methanesulfonate (EMS) and ultra-violet light was quantitated by autoradiography and by scintillation spectrometry on acid precipitable macromolecules or DNA insolated by isopycnic banding in cesium chloride (CsCl). Dose-dependent increases in UDS due to N-OH-AAF and AFB1 treatment were found. Only 2-fold increases at the highest dose levels were found, however, when incorporated [3H]thymidine was quantitated by scintillation spectrometry. Seven, 11, and 25-fold increases in UDS induced by AFB1, N-OH-AAF and ultra-violet light, respectively, were found when incorporated [3H]thymidine was quantitated by autoradiography, indicating a high sensitivity for detecting 'long patch' repair by this technique. Scintillation spectrometry was completely ineffective in detecting EMS-induced UDS, whereas autoradiography demonstrated a small, but significant induction in [3H]thymidine incorporation at high dose levels. The non-proliferative nature of the primary hepatocyte prohibits the uniform radioactive prelabeling of DNA, necessary in other techniques, for the detection of 'short patch' repair induced by compounds such as EMS. Therefore, the sensitivity of the primary cultured rat hepatocyte in conjunction with UDS for detecting DNA damage caused by mutagens and carcinogens which induce 'short patch' repair may be limited to the autoradiographic analysis of the unscheduled incorporation of [3H]thymidine.

Aflatoxins↗
PubMed1979

Length heterogeneity of amplified circular rDNA molecules in oocytes of the house cricket Acheta domesticus (Orthoptera: Gryllidae).

Amplification of the genes coding for rRNA occurs in the oocytes of a wide variety of organisms. The amplification process appears to be mediated through a rolling-circle mechanism. The approximate molecular weight of the smallest rDNA circles is equivalent to the estimated combined molecular weight of DNA which codes for a single ribosomal RNA precursor molecule and an associated non-transcribed spacer DNA sequence. RNA-DNA hybridization studies carried out on oocytes of the house cricket, Acheta domesticus, suggest that DNA coding for rRNA accounts for only a small fraction of the rDNA satellite, all of which is amplified in the oocyte. In order to test the possibility that the remainder of the amplified rDNA represents spacer and to determine whether a rolling-circle mechanism might also be involved in amplification in A. domesticus oocytes, rDNA was isolated from ovaries of A. domesticus and spread for electron microscopy. A large proportion of the rDNA isolated from ovaries is circular, while main-band DNA and rDNA prepared from other tissues demonstrates few if any circles. The mean size of the smallest rDNA circles is approximately 8 times longer than the length estimated for DNA which codes for 18S and 28 S rRNA. Denaturation mapping shows the rDNA circles to contain two major readily denaturing regions located about equidistant from one another on the circle. Each readily denaturing region accounts for 4--6% of the total DNA in the circle. The fact that only 12% of the average molecule is required to code for A. domesticus 18S and 28S rRNA is consistent with the hybridization data. Considerable size heterogeneity exists in the length of the smallest class of rDNA molecules. In the rDNA of other species such heterogeneity has been shown to reside in the non-transcribed spacer.

Animals↗
PubMed1978

2-acetylaminofluorene-induced unscheduled DNA synthesis in hepatocytes isolated from 3-methylcholanthrene treated rats.

The dose-dependent induction of unscheduled DNA synthesis (UDS) by 2-acetylaminofluorene (AAF) and N-OH-2-acetylaminofluorene (N-OH AAF) in primary rat hepatocytes isolated from untreated and 3-methylcholanthrene (3-MC) treated rats was investigated. 3-MC treatment was not necessary for the dose-dependent induction of UDS induced by N-OH AAF, suggesting the presence of enzyme levels adequate for its esterification to an active form in isolated primary hepatocytes. Although all doses of AAF increased the level of [3H]thymidine incorporation above that of the control, a dose-dependent response could not be demonstrated, suggesting inadequate constitutive levels of N-hydroxylating enzymes. Treatment of rats with 3-MC 24 h prior to hepatocyte isolation resulted in a dose-dependent induction of UDS by AAF. 3-MC treatment increased the amount of UDS per cell, as well as the percentage of cells induced to repair their DNA.

2-Acetylaminofluorene↗
PubMed1976

Absence of rDNA amplification in the uninucleolate oocyte of the cockroach Blattella germanica (Oorthoptera: Blattidae).

Amplification of the genes coding for ribosomal RNA oocurs in the oocytes of a wide variety of organisms. In oocytes of various species of crickets (Orthoptera: Gryllidae) the amplified DNA is contained in a large extrachromosomal DNA body. Multiple nucleoli form about the periphery of the DNA body during the diplotene stage of meiosis I. In contrast to the general pattern of orthopteran oocytes, oocytes of the cockroach Blattella germanica demonstrate a single large nucleolus instead of many nucleoli. In order to determine whether the genes coding for rRNA are amplified in the oocytes of B. germanica, the relative amount of rDNA in oocytes was compared with the rDNA content of spermatocytes and somatic cells. An extrachromosomal DNA body similar to that present in crickets is not present in B. germanica. A satellite DNA band which contains nucleotide sequences complementary to rRNA accounts for approximately 3-5% of the total DNA in somatic and in male and female gametogenic tissues. Female cells contain approximately twice as much rDNA as do male cells. An XX-XO sex-determining mechanism is operative in B. germanica. In situ hybridization with rRNA indicates that the nucleolar organizer is located on one end of the X chromosome and that oocytes do not contain more than twice the amount of rDNA found in spermato cytes. The data indicate that rDNA is not amplified in the uninucleolate oocyte of B germanica.

Animals↗
PubMed1975

Absence of ribosomal DNA amplification in the meroistic (telotrophic) ovary of the large milkweed bug Oncopeltus fasciatus (Dallas) (Hemiptera: Lygaeidae).

In the typical meroistic insect ovary, the oocyte nucleus synthesizes little if any RNA. Nurse cells or trophocytes actively synthesize ribosomes which are transported to and accumulated by the oocyte. In the telotrophic ovary a morphological separation exists, the nurse cells being localized at the apical end of each ovariole and communicating with the ooocytes via nutritive cords. In order to determine whether the genes coding for ribosomal RNA (rRNA) are amplified in the telotrophic ovary of the milkweed bug Oncopeltus fasciatus, the percentages of the genome coding for ribosomal RNA in somatic cells, spermatogenic cells, ovarian follicles, and nurse cells were compared. The oocytes and most of the nurse cells of O. fasciatus are uninucleolate. DNA hybridizing with ribosomal RNA is localized in a satellite DNA, the density of which is 1.712 g/cm(-3). The density of main-band DNA is 1.694 g/cm(-3). The ribosomal DNA satellite accounts for approximately 0.2% of the DNA in somatic and gametogenic tissues of both males and females. RNA-DNA hybridization analysis demonstrates that approximately 0.03% of the DNA in somatic tissues, testis, ovarian follicles, and isolated nurse cells hybridizes with ribosomal RNA. The fact that the percentage of DNA hybridizing with rRNA is the same in somatic and in male and female gametogenic tissues indicates that amplification of ribosomal DNA does not occur in nurse cells and that if it occurs in oocytes, it represents less than a 50-fold increase in ribosomal DNA. An increase in total genome DNA accounted by polyploidization appears to provide for increasing the amount of ribosomal DNA in the nurse cells.

Animals↗