PubMed Health⌕ Search

Biomedical subjects

M D Edge

Publications and source records attributed to M D Edge.

31 records · Page 2Linked to original sources
PubMed1984

Isolation of a complementary DNA clone for the human complement protein C2 and its use in the identification of a restriction fragment length polymorphism.

Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases.

Amino Acid Sequence↗
PubMed1984

Cloning of human prealbumin complementary DNA. Localization of the gene to chromosome 18 and detection of a variant prealbumin allele in a family with familial amyloid polyneuropathy.

Prealbumin, a 55,000 Mr protein, is a normal constituent of human serum. In patients with familial amyloid polyneuropathy (FAP), an autosomal dominant disease, variant prealbumin molecules are found in association with systemic amyloid deposits. One variant prealbumin has a methionine for valine substitution at amino acid 30 and has been implicated in the pathogenesis of type 1 FAP. A prealbumin-specific complementary DNA clone has been isolated from an adult human liver library and used in Southern blot hybridization experiments to identify a unique NsiI restriction endonuclease site in the variant allele carried by type 1 FAP patients with the methionine for valine substitution. The complementary DNA clone has been used to analyse a panel of human-mouse and human--hamster somatic cell hybrid DNAs and localize the prealbumin gene to chromosome 18.

Alleles↗
PubMed1983

Chemical synthesis of a human interferon-alpha 2 gene and its expression in Escherichia coli.

A 511-base pair DNA fragment encoding human interferon-alpha 2 has been chemically synthesised and expressed from a lac UV5 and a synthetic trp promoter in Escherichia coli. The synthesis involved preparation of 68 oligodeoxyribonucleotides and their enzymic ligation. The product expressed from the trp promoter system had high antiviral activity and displayed biological effects similar to those of Namalwa interferon on natural killer cell activity and in a Daudi cell growth inhibition assay. E.coli minicells containing plasmid DNA with the synthetic IFN-alpha 2 gene under trp promoter control produce a protein with the same electrophoretic mobility as a sample of authentic IFN-alpha 2. The protein from E.coli cross-reacts with the monoclonal antibody NK-2 and was readily purified, close to homogeneity, by immunoadsorption chromatography on NK-2 sepharose.

Amino Acid Sequence↗
PubMed1983

Ion-exchange high-performance liquid chromatography of oligodeoxyribonucleotides using formamide.

The superiority of buffer systems containing formamide for the ion-exchange high-performance liquid chromatographic separation of oligodeoxyribonucleotide mixtures generated in solid-phase syntheses is illustrated. The resolutions achieved are compared to those achieved with the same mixtures in other eluting solvents. The use of formamide systems is recommended for oligodeoxyribonucleotide purification in general and is particularly valuable where the oligonucleotide of interest is highly self-complementary and/or rich in deoxyguanosine residues.

Chromatography, High Pressure Liquid↗
PubMed1982

The construction of a synthetic Escherichia coli trp promoter and its use in the expression of a synthetic interferon gene.

An 82 base pair DNA fragment has been synthesised which contains the E. coli trp promoter and operator sequences and also encodes the first Shine Dalgarno sequence of the trp operon. This DNA fragment is flanked by EcoRI and ClaI/TaqI cohesive ends and is thus easy to clone, transfer between vector systems and couple to genes to drive their expression. It has been cloned into plasmid pAT153, producing a convenient trp promoter vector. We have also joined the fragment to a synthetic IFN-alpha 1 gene, using synthetic oligonucleotides to generate a completely natural, highly efficient bacterial translation initiation signal on the promoter proximal side of the IFN gene. Plasmids carrying this construction enable E. coli cells to express IFN-alpha 1 almost constitutively and with significantly higher efficiency than from a lacUV5 promoter based system.

Base Composition↗
PubMed1982

Targeted point mutation that creates a unique Eco RI site within the signal codons of the beta-lactamase gene without altering enzyme secretion or processing.

A method has been developed for constructing site-specific mutations by using a strongly selectable marker on which to "piggy-back" a desired mutation that may be phenotypically silent. Using this approach, a new unique Eco RI restriction site has been generated at the beginning of the signal codons of the beta-lactamase gene of the plasmid pBR322. The consequential alteration of the second amino acid of the signal from Ser to Arg has no effect on either the transport or the processing of the beta-lactamase.

Base Sequence↗
PubMed1981

Total synthesis of a human leukocyte interferon gene.

A 514-base pair fragment of double-stranded DNA coding for human interferon-alpha 1 (166 amino acid residues), and containing initiation and termination signals plus appropriate restriction enzyme sites for plasmid insertion, has been totally synthesized. The synthesis involved preparation of 66 oligodeoxyribonucleotides, ranging in size from 14 to 21 residues, plus 1 deoxydecanucleotide, by rapid, solid phase procedures, and enzymatic ligation of the oligonucleotides. After ligation of the synthetic gene to a plasmid vector and transformation of Escherichia coli, clones containing the anticipated gene sequence were obtained.

Base Sequence↗
PubMed1980

Solid phase phosphotriester synthesis of large oligodeoxyribonucleotides on a polyamide support.

Phosphotriester solid phase methodology on a polyamide support [(1980) Nucleic Acids Research, 8, 1081-1096] has been extended for the rapid synthesis of the tetradecanucleotide, d(AGTTGTTTGTAGTT), the octadecanucleotide, d(GTGGGTTTGGGGCAGGTC), and the heneicosanucleotide, d(GTGCTCTTATCCTCTTGGCTC). Thus, oligodeoxyribonucleotides comparable in size to those obtained by solution synthesis are readily accessible using solid phase techniques. An approach to the purification of the synthetic octadecanucleotide without recourse to high performance liquid chromatography is described.

Base Sequence↗