PubMed Health⌕ Search

Biomedical subjects

M F Lavin

Publications and source records attributed to M F Lavin.

At least 145 records · Page 8Linked to original sources
PubMed1990

Transferrin receptor expression in primary superficial human bladder tumours identifies patients who develop recurrences.

A group of 65 patients with superficial bladder carcinoma was followed for 2 years and tumour recurrence rate was correlated both with transferrin receptor status of the initial primary tumour and with the results of voided urine cytology. Nine of 24 patients with transferrin receptor negative tumours had recurrences compared with 30 of 41 patients with transferrin receptor positive tumours. This difference was highly significant. Urine cytology at presentation was also predictive of further tumour formation: of 30 patients who were transferrin receptor positive and had positive urine cytology, 25 developed recurrences.

Adult↗
PubMed1990

RAS oncogene product expression in normal and malignant oral mucosa.

Proto-oncogenes are important in both normal cellular differentiation and in carcinogenesis. The majority of transforming genes belong to the ras family and the ras gene product has been shown to be elevated in some oral carcinomas. RAP-5 monoclonal antibody was used to determine the expression of the p21ras protein in normal and neoplastic oral mucosa in an immunohistological study. The expression of p21ras protein was generally restricted to acanthous cells with strong staining in normal oral mucosa and well-differentiated carcinomas. In contrast, the p21ras protein was not detected in significant amounts in severely dysplastic lesions and poorly differentiated carcinomas. These results suggest that expression of p21ras is a normal feature of more fully differentiated tissues, both normal and neoplastic, and is not useful as an indicator of cell proliferation or 'malignant potential'.

Antibodies, Monoclonal↗
PubMed1990

DNA-binding protein activated by gamma radiation in human cells.

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

Base Sequence↗
PubMed1990

Neutron and gamma-irradiation of bacteriophage M13 DNA: use of standard neutron irradiation facility (SNIF).

We describe here the use of the Van de Graaff accelerator as a source of high energy neutrons for biological irradiation. Single-stranded bacteriophage M13 DNA was chosen as the system to determine the relative biological effectiveness of monoenergetic neutrons. A Standard Neutron Irradiation Facility (SNIF) was established using a 3 MV Van de Graaff accelerator. The 2D (d,n)3He nuclear reaction was used to produce neutron fluxes of 3 x 10(8) cm 2 sec-1 yielding dose rates as high as 50 Gy h-1. A detailed description of the neutron source, neutron fluence measurement, dose calculation and calibration are included. Exposure of single-stranded bacteriophage M13 DNA to 90 Gy of neutrons reduced survival to 0.18% of the unirradiated value. 500 Gy of gamma-rays were required for the same level of killing, and RBE was estimated at 6 based on Do values. Determination of the extent of DNA damage after exposure to cleavage using gel electrophoresis, gave RBE values of 6-8 which was very similar to that observed for bacteriophage survival. The facility described here provides a reproducible source of high energy monoenergetic neutrons and dose levels suitable for experiments designed to measure DNA damage and effects on DNA synthesis.

Coliphages↗
PubMed1990

Defective DNA topoisomerase II in ataxia-telangiectasia cells.

A number of characteristics in the human genetic disorder ataxia-telangiectasia are compatible with an alteration to chromatin structure or the recognition of that structure by an enzyme or DNA binding protein. We describe here reduce activity of DNA topoisomerase type II in a number of Epstein Barr Virus-transformed ataxia-telangiectasia lymphoblastoid cell lines. Enzyme activity was reduced 10-fold or greater in 4 out of 5 cell lines compared to controls. In the remaining cell line approximately a 2-3 fold reduction was evident in partially purified extracts. DNA topoisomerase type I activity was found to be the same as controls in all the cell lines. Northern blot analysis revealed that the same level of DNA topoisomerase II mRNA was expressed in ataxia-telangiectasia and control cell lines. The size and amount of the enzyme did not differ appreciably from that observed in control cells. The reduced activity of DNA topoisomerase II in ataxia-telangiectasis cells might be explained by amino acid substitutions, small deletions in DNA or by a defect in post-translational modification in these cells.

Ataxia Telangiectasia↗
PubMed1989

Observations on blood leucocytes and lymphocyte subsets in sheep infected with bovine leukaemia virus: a progressive study.

Haematological parameters and reactivity of lymphocyte antigens to monoclonal antibodies were studied over a 10-month period in sheep experimentally infected with bovine leukaemia virus (BLV). BLV-inoculated animals seroconverted within 1 month and showed a significant lymphocytosis 2-6 weeks after infection. Control animals inoculated with BLV-free lymphocytes showed a stronger and more immediate neutrophil response than those inoculated with BLV-positive lymphocytes. One month after infection, BLV-inoculated sheep showed a relative increase of cells bearing antigens T4, T6, T8 and T19, and 10 months into the trial, MHC II lymphocytes increased, T6 remained elevated, but T4 helper cells were significantly decreased in number. Lymphoma tissue showed the presence of T8 cells, and lymph nodes from seroconverted sheep had areas of concentrated T4 staining cells. These results demonstrate responses in cellular immune mechanisms to infection with BLV.

Animals↗
PubMed1989

Changes in B cell and T cell subsets in bovine leukaemia virus-infected cattle.

Direct immunofluorescence and fluorescence-activated cell sorter techniques were used for the detection of surface immunoglobulin positive (SIg+) cells in peripheral blood lymphocytes (PBL's) of bovine leukaemia virus (BLV) infected cattle with or without persistent lymphocytosis (PL+, PL-) and in BLV-free cattle. The percentage of SIg+ cells was more than twice as high in BLV+PL+ cattle than in BLV-free and BLV+PL- cattle. Bovine T cells, and T cell subsets were identified indirectly by the same techniques using three monoclonal antibodies (MAb's) specific for all T cells (IL-A43), T helper (BoT4) cells (IL-A12) and T cytotoxic (BoT8) cells (IL-A17). The major histocompatibility complex (MHC) determinants of both class II (BoT4) and class I (BoT8) as well as all T cells were significantly reduced in BLV+PL+ compared to BLV-free cattle. The actual decrease in the BoT8 cell subset or the dilution effect that would change effector:target cell ratio suggests that a resultant decrease in cytotoxic activity in BLV+PL+ cattle may play an important role in the progress of BLV infection in cattle.

Animals↗
PubMed1989

Molecular changes associated with induction of cell death in a human T-cell leukaemia line: putative nucleases identified as histones.

Following treatment of the human T-cell leukaemia line, CEM-C7, with the glucocorticoid, dexamethasone, a rapid decrease in viability occurred after 40 h which coincided with fragmentation of DNA in these cells. A similar pattern of DNA fragmentation was observed when these cells were gamma-irradiated or treated with cycloheximide. Distinct morphological changes occurred after treatment, indicating a form of cell death, regulated from within, termed apoptosis. A set of nuclear proteins ranging in size from 10-18 kDa appeared by 40 h following treatment with dexamethasone. Treatment of cells with gamma-irradiation or cycloheximide also produced the same protein pattern. This set of proteins, and a doublet approximately 55 kDa in size, had apparent nuclease activity which was not observed in untreated cells. However, protein microsequencing of these bands in the 10-18 kDa region revealed that they were histone proteins. These results cast doubt on a recent report which provided evidence that these proteins were induced nucleases.

Amino Acid Sequence↗
PubMed1989

Abnormality in DNA-protein binding in ataxia-telangiectasia nuclear extracts.

Anomalies in DNA replication, repair and recombination in ataxia-telangiectasia (A-T) point to a defect in structure or function of chromatin. In this study we have compared DNA-protein binding in nuclear extracts from control and A-T cells using two assay systems, filter-binding and DNA-accessibility. Interestingly, the extent of DNA protein binding over a range of protein concentration was significantly lower in A-T extracts. In addition the accessibility of the restriction enzyme Eco R1 to protein-bound plasmid was greater when A-T extracts were used. This is in keeping with the reduced binding observed in the filter-binding assay.

Ataxia Telangiectasia↗
PubMed1989

Cell death by apoptosis in acute leukaemia.

We have previously demonstrated that when freshly isolated childhood T-cell acute lymphoblastic leukaemia cells are incubated in growth medium after isolation from blood, chromatin is rapidly cleaved into nucleosomal sized fragments that are multiples of 200 bp. The fragmentation is similar to that observed in other types of cells undergoing apoptosis or programmed cell death. In this study we describe a more comprehensive approach to the study of DNA fragmentation in leukaemia. Fragmentation was observed in freshly isolated cells from patients with T-cell acute lymphoblastic leukaemia and in one with common acute lymphoblastic leukaemia. Frozen samples of T-cell acute lymphoblastic leukaemia, common acute lymphoblastic leukaemia, and acute myeloid leukaemia cells also showed fragmentation of DNA. However, no fragmentation was evident in normal leukocytes treated under the same conditions. Ultrastructural studies on the isolated leukaemia cells demonstrate that the chromatin cleavage observed biochemically is associated with morphological changes characteristic of apoptosis.

Cell Survival↗
PubMed1989

Conserved DNA sequences in chlamydial plasmids.

Two 7.4-kb plasmids from Chlamydia psittaci have been cloned and characterized. These plasmids are quite distinct from the 6.2-kb C. psittaci and the C. trachomatis plasmids when compared by restriction endonuclease analysis. The plasmids show considerable cross-hybridization, with only a small region highly conserved and identified as a 4 X 22-bp tandemly repeated region. This sequence is identical in the two size categories of C. psittaci plasmids and differs from C. trachomatis plasmids by only 2 bp in the 22-bp motif. AT-rich clusters 5' to the repeat region which are present in C. trachomatis and Escherichia coli plasmids were absent from both classes of C. psittaci plasmids. Extensive regions are less highly conserved but show a sufficient degree of cross-hybridization to suggest that the plasmids are homologous.

Animals↗
PubMed1989

Detection of Chlamydia psittaci in free-ranging koalas (Phascolarctos cinereus): DNA hybridization and immuno-slot blot analyses.

DNA-slot hybridization and immuno-slot blot analyses were compared for the detection of Chlamydia psittaci in crude swab material from free-ranging koalas. Immuno-slot blot analysis detected chlamydiae in 43 out of 68 koalas, with the sensitivity of the assay varying from 52 to 73% depending on the site of infection. Gene probe analysis was also used employing a genus-specific probe pCKO-10 isolated from a koala chlamydial gene library (ocular strain) and a plasmid probe pCKU cloned from a urogenital strain. The sensitivity of these two assays was comparable and they were considerably more efficient than the immuno-slot blot method for the detection of chlamydiae. Comparison of these data with a cell-culture method of detection, previously used with the same samples, demonstrated that gene probe analysis detected more positives than observed with cell culture. However, this appears to reflect more on the condition of the swab material rather than the sensitivity of the method.

Animals↗
PubMed1989

Comparison of gamma-radiation-induced accumulation of ataxia telangiectasia and control cells in G2 phase.

Recent reports from a number of laboratories have linked radiosensitivity in ataxia telangiectasia (A-T) to a large and prolonged block of some cells in G2 phase. Previous results from this laboratory, largely with one Epstein-Barr virus-transformed A-T lymphoblastoid cell line, presented evidence for a dramatic increase in the number of cells in G2 phase over controls during a 24-h period post irradiation. We describe here a study of the effect of gamma-radiation on G2 phase delay in several A-T cell lines. Based on previous results with several cell lines 24 h post irradiation was selected as the optimum time to discriminate between G2 phase delay in control and A-T cells. All A-T homozygotes showed a significantly greater number of cells in G2 phase, 24 h post irradiation, than observed in controls. A more prolonged delay in G2 phase after irradiation was seen in different A-T cell types that included lymphoblastoid cells, fibroblasts and SV40-transformed fibroblasts. At the radiation dose used it was not possible to distinguish A-T heterozygotes from controls.

Ataxia Telangiectasia↗
PubMed1989

Normal inhibition of DNA synthesis following gamma-irradiation of radiosensitive cell lines from patients with Down's syndrome and Alzheimer's disease.

Inhibition of DNA synthesis was studied in gamma-irradiated lymphoblastoid cells from patients with Alzheimer's disease and Down's syndrome. A normal biphasic pattern of inhibition was observed over a dose range of 0-4 krad of gamma-rays in all of the cell lines. 3 out of 4 Down's and all the Alzheimer's cell lines were shown to be hypersensitive to ionizing radiation based on induced chromosomal aberrations. Increased G2 phase delay, comparable to that occurring in ataxia-telangiectasia cells, was observed for some of the cell lines, after exposure to gamma-rays. Contrary to other data in the literature these results demonstrate that radioresistant DNA synthesis is not an intrinsic feature of all disorders characterized by radiosensitivity.

Alzheimer Disease↗
PubMed1989

Origin of rare Ha-ras alleles: relationship of VTR length to a 5' polymorphic Xho I site.

Amongst the four common Ha-ras alleles in both controls and cancer patients, we detected the presence of a polymorphic Xho I site associated specifically with the 6.6 and 7.7 kb Bam HI fragments but absent from the 7.1 and 8.2 kb alleles, as recently reported by others. We have extended this study and report here, the consistent appearance of this Xho I site in unusual alleles close in size to the two common alleles of 6.6 and 7.7 kb, in control lymphoblastoid DNA samples in a variety of tumor DNAs. Unusual alleles grouped around the 7.1 and 8.2 kb common alleles on the other hand, did not possess the Xho I site. The consistent presence of the Xho I site polymorphism, in the unusual Ha-ras alleles surrounding the 6.6 and 7.7 kb common alleles and its absence in alleles around the 7.1 and 8.2 kb common alleles, suggests that the unusual ones are derived from the corresponding common alleles to which they are closest in size.

Alleles↗
PubMed1989

New cyclic peptides with cytotoxic activity from the ascidian Lissoclinum patella.

The isolation and structures of a new patellamide (patellamide D) and two new lissoclinamides (lissoclinamides 4 and 5) from the aplousobranch ascidian Lissoclinum patella are described. Structures were determined largely by using two-dimensional NMR techniques and mass spectrometry. These peptides and other members of the patellamide and lissoclinamide families that have been reported previously are found within the obligate algal symbiont of the genus Prochloron. The cytotoxicities of the compounds toward fibroblast and tumor cell lines are reported. One of these compounds, lissoclinamide 4, is markedly more toxic than other members of the family. Structure-activity relationships are discussed.

Animals↗
PubMed1989

Novel cytotoxic compounds from the ascidian Lissoclinum bistratum.

The isolation and structures of two new cyclic hexapeptides and two new macrocyclic ethers from the aplousobranch ascidian Lissoclinum bistratum are described. Their structures were determined by two-dimensional NMR techniques. The hexapeptides, named bistratamide A and bistratamide B, differ only by the presence or absence of one double bond. They were tested for cytotoxicity toward human fibroblast and tumor cell lines and displayed similar toxicities to the octapeptides called patellamides from Lissoclinum patella. The peptides are found within the obligate algal symbiont Prochloron but clearly differ from peptides isolated from the same Prochloron of L. patella. The macrocyclic ethers isolated from L. bistratum are exceedingly potent in cytotoxicity. They have been named bistratenes A and B, and structures for these compounds are proposed.

Acetamides↗