PubMed Health⌕ Search

Biomedical subjects

M Inouye

Publications and source records attributed to M Inouye.

At least 469 records · Page 26Linked to original sources

Development-specific protein S of Myxococcus xanthus: purification and characterization.

Protein S, a development-specific protein of Myxococcus xanthus, was purified from the cells of a late stage of development and crystallized. Its circular dichroism spectra indicated that protein S had a high content of beta-structure in both the presence and absence of calcium ion, which is required for self-assembly of protein S on the myxospore surface. Its amino and carboxyl terminal sequences were determined to be alanine-aspartic acid-isoleucine-glycine-valine-alanine-methionine-asparagine-asparagine-aspartic acid-threonine-serine-serine and isoleucine-arginine (isoleucine, serine), respectively. When protein S (molecular weight, 23,000) was digested with trypsin, a trypsin-resistant core of 10,000 molecular weight was obtained. The core peptide was purified, and its amino acid composition was compared with that of protein S. The core peptide was capable of self-assembly on the spore surface in the presence of calcium ion and competed with protein S for binding on the spore surface. The ratio of affinity to the spore surface for protein S to that for the core peptide was 1.55.

Amino Acid Sequence↗

Two-step cloning of the Escherichia coli regulatory gene ompB, employing phage Mu.

It is difficult to clone directly some regulatory or structural genes on the basis of their functions, because of their obscure properties or the leakiness of their mutants. To overcome this problem, a two-step cloning method with use of phage Mu was developed and applied to cloning of the ompB gene, an obscure regulatory gene for major outer membrane proteins of Escherichia coli. The ompB gene was first inactivated by phage Mu insertion, and the approximately 25-kilobase (kb) EcoRI fragment, which hybridized with phage Mu DNA, was cloned into a plasmid vector, pBR322. This DNA fragment was considered to contain not only a portion of phage Mu DNA but also a portion of the ompB gene DNA. With this DNA as a probe, the wild-type ompB+ strain was found to contain a 12.7-kb EcoRI fragment which hybridized with the probe. In the second step, this 12.7-kb EcoRI fragment was cloned into a lambda phage vector, lambda 569. Lysogenization of an ompB mutant with this phage suppressed OmpB- phenotypes, indicating that the 12.7-kb EcoRI fragment carried the ompB gene. The same 12.7-kb DNA fragment, as well as a 3.8-kb EcoRI-BamHI subfragment, was cloned into pBR322. Both plasmid clones were able to suppress the OmpB- phenotypes upon transformation of an ompB mutant.

Bacterial Proteins↗

Temporal and spatial patterns of Purkinje cell formation in the mouse cerebellum.

In an attempt to determine the time of origin and the final localization of Purkinje cells in the cerebellum, pregnant mice were injected with tritiated thymidine successively, four to six times daily, beginning on either day 10, 11, 12, 12.5, 13, or 14 of gestation, considering 6 a.m. on the day when vaginal plugs were found as day 0. Offspring were killed at 30 days of age, and serial sagittal sections of the cerebellum were prepared for autoradiography. Labeled and unlabeled Purkinje cells in the various regions of the cerebellum were counted, and unlabeled ones were considered to be formed earlier than the initiation of the injections. In the medial level of the vermis, the majority of the Purkinje cell population was formed on day 12 of gestation and a few on day 13, whereas the cells in the paravermian and hemispheric portions were formed on days 11 and 12. Thus, a slight lateromedial gradient of the time of Purkinje cell origin was demonstrated. Purkinje cells that were formed after day 12.5 were distributed more in the vermis than in the hemisphere, more in the ventral region of the vermis (lingula, ventral lobule of lobulus centralis, and nodulus) than in the dorsal region (culmen, declive, tuber, pyramis, and uvula), and deep in the vermian fissures, rather than on the surface of the lobules. These findings suggest that postnatally, early maturing regions of the cerebellum may have received many of the later formed Purkinje cells.

Animals↗

Preliminary crystallographic data for protein S, a development-specific protein of Myxococcus xanthus.

Protein S, which is produced only during the developmental cycle of Myxococcus xanthus, has been crystallized using 2-methyl-2,4-pentanediol as a precipitating agent. The crystals were very stable in the x-ray beam for up to 150 h and diffracted to a resolution of 2.2 A. The crystals belong to the orthorhombic space group P212121 with unit cell dimensions a = 52.99 A, b = 60.10 A, and c = 102.16 A. Each asymmetric unit consists of two monomers of Protein S, each having a molecular weight of 23,000.

Bacterial Proteins↗

Strain-specific variations in the folial pattern of the mouse cerebellum.

The folial pattern of the mouse cerebellum was compared in 13 inbred strains and a closed colony. The morphological variation of the cerebellum among individual animals was slight within each inbred strain, whereas it was marked in the closed colony. There was no sex-related difference in the cerebellar folial pattern. The cerebellum of mice from each inbred strain presented a characteristic folial pattern in which some similarities were recognized among animals from genetically related strains. These findings revealed that the morphological variation in the folial pattern of the cerebellum was strain-specific in mice and had an intimate connection with the genetic control.

Animals↗

Messenger ribonucleic acid of the lipoprotein of the Escherichia coli outer membrane. I. Nucleotide sequence at the 3' terminus and sequences of oligonucleotides derived from complete digests of the mRNA.

The sequence of 92 nucleotides at the 3' end of the mRNA which codes for the lipoprotein of the outer membrane of Escherichia coli has been determined to be GCUAACCAGCGUCUGGACAACAUGGCUACUAAAUACCGCAAGUAAUAGUACCUGUGAAGUGAAAAAUGGCGCACAUUGUGCGCCAUUUUUUUOH. This sequence includes the 50 nucleotides comprising the 3' untranslated region of the mRNA and contains codons for 14 amino acids at the COOH-terminal of the lipoprotein. In addition, the nucleotide sequences of all oligonucleotides derived from complete ribonuclease T1 and ribonuclease A digestions of the lipoprotein mRNA were established. These oligonucleotides were assigned to portions of the known amino acid sequence as well as the 5' untranslated and 3' untranslated regions of the mRNA molecule. With the use of the genetic code, these oligonucleotide sequences served to establish 94% of the mRNA sequence. The lipoprotein mRNA can be deduced to be 322 nucleotides in length. All three translation termination codons (UAA, UAG, and UGA) were found in phase with the coding region of the mRNA. The region at the 3' end of the mRNA showed unusual resistance to partial degradation, and the partial fragments from this region had anomalous mobilities in two-dimensional gels, even under denaturing conditions. This indicates that there is a very stable hairpin stem-and-loop structure at the 3' end. This hairpin structure exhibits all the structural elements implicated in termination of transcription in, prokaryotes.

Base Sequence↗

Messenger ribonucleic acid of the lipoprotein of the Escherichia coli outer membrane. II. The complete nucleotide sequence.

The complete nucleotide sequence of the mRNA for the outer membrane lipoprotein from Escherichia coli has been determined. All the ribonuclease T1 and ribonuclease A fragments obtained from the mRNA were connected with DNA sequencing of restriction endonuclease fragments of the cloned lipoprotein gene. The mRNA consists of 322 nucleotides, and there are 38 and 50 nucleotides in the 5' and 3' end untranslated regions, respectively. The mRNA has several unique features: (a) Out of 50 possible codons for 15 amino acids in the prolipoprotein only 25 codons are used, and all of these appear to be read by the major isoaccepting species of tRNAs for individual amino acids. (b) In the first 64 nucleotides from the 5' end, there are no obvious secondary structures. On the other hand, between the 65th nucleotide and the 3' end, 85% of the nucleotides are involved in the formation of secondary structures, with nine stable stem-and-loop structures. (c) There are many repeating sequences including one repeat of 40 nucleotides. (d) There are a few other features which could be important for efficient translation of the mRNA.

Base Sequence↗

Amino acid sequence of the signal peptide of ompA protein, a major outer membrane protein of Escherichia coli.

The structural gene for ompA protein, a major outer membrane protein of Escherichia coli, was cloned using the plasmid cloning vehicle, pMF21. The DNA sequence corresponding to the signal peptide of pro-ompA protein, a secretory precursor of ompA protein, was determined. The amino acid sequence of the signal peptide was deduced from the DNA sequence as follows: Met-Lys-Lys-Thr-Ala-Ile-Ala-Ile-Ala-Val-Ala-Leu-Ala-Gly-Phe-Ala-Thr-Val-Ala-Gin-Ala-. The amino acid sequence complies with all the features of the loop model proposed for the mechanism of protein secretion across the cytoplasmic membrane.

Amino Acid Sequence↗

DNA sequence of the Serratia marcescens lipoprotein gene.

The Serratia marcescens gene for the outer membrane lipoprotein (lpp) was cloned in lambda phage vector Charon 14. The recombinant phage was very unstable, and the lpp gene with a 300-base-pair deletion at the transcription termination site was further cloned in pBR322. The DNA sequence of 834 base pairs encompassing the lpp gene was determined and compared with that of the Escherichia coli lpp gene. The sequence comparisons exhibit several unique features. (i) The promoter region is highly conserved (84% homology) and has an extremely high A+T content (78%) as in E. coli (80%). (ii) The 5' nontranslated region of the lipoprotein mRNA is also highly conserved (95% homology). (iii) In the DNA sequence corresponding to the signal peptide of this secretory protein, there are three drastic changes, including addition of one base pair and deletion of four base pairs in S. marcescens as compared to E. coli. The resultant alterations in the amino acid sequence, however, do not change the basic properties of the signal peptide, which are assumed to be essential for its function in the secretory mechanism. (iv) The DNA sequence from the amino terminus to the 51st residue of the mature lipoprotein is highly conserved (95% homology) and there is no amino acid substitution. (v) The DNA sequence corresponding to the seven amino acid residues at the carboxyl terminus has only 42% homology, resulting in four amino acid substitutions. (vi) Within the section of 40 base pairs beginning with the termination codon (UAA) and ending immediately before the oligo(T) transcription termination site in the E. coli lpp gene, there is about 60% homology. However, after this section, there is no obvious homology between the two sequences, probably because of a deletion of 300 base pairs at this region. (vii) Seven stable stem-and-loop structures could be formed in the mRNA region. (viii) Alterations in the third position of codons used in the lpp gene suggest that the gene has evolved somewhat differently from other genes in S. marcescens.

Amino Acid Sequence↗

Regulatory region of the gene for the ompA protein, a major outer membrane protein of Escherichia coli.

The ompA protein, an outer membrane protein required for conjugation, is one of the most abundant proteins in Escherichia coli. The structural gene for the ompA protein cloned in a plasmid vector, pMF21, conferred sensitivity to ompA protein-specific phages. We have determined the DNA sequence of a fragment of 533 base pairs encompassing the regulatory region of the ompA gene: the promoter region, the 5'-untranslated region, and the region corresponding to the signal peptide for this secretory protein. The promoter region has a sequence that is remarkably homologous with the lac and gal promoters. Particularly, both the ompA and gal promoters have the same octanucleotide sequence, T-C-A-C-A-C-T-T, in their RNA polymerase recognition site, which has been shown to be involved in the binding of cyclic AMP receptor protein to the gal promoter. Analogous with the observations in the gal operon, a specific RNA transcript was produced only when glycerol, a DNA-destabilizing agent, was added to a cell-free system directed by a DNA fragment of the ompA gene. These data indicate that the ompA mRNA has an untranslated region at the 5' end of about 140 nucleotides. In this region there are two additional initiation codons (II and III) besides the initiation codon (I) for the pro-ompA protein. AUG-III is located 30 bases upstream from AUG-I and accompanies a ribosome-binding site. Therefore, AUG-III is likely to begin the synthesis of a pentapeptide. The termination codon for the peptide overlaps with AUG-II, so that the ribosomes could reinitiate from AUG-II without being released from the mRNA. This reinitiation leads to the synthesis of a heptapeptide. The termination codon for this peptide also overlaps with AUG-I, which initiates the production of the pro-ompA protein. Because AUG-I also has an adjacent ribosome-binding site, the tandem repeat of initiation codons and ribosome-binding sites may be an important mechanism for facilitating the rate of initiation of translation. Extensive secondary structures exist in the 5' end as well as in the coding region of the ompA mRNA, which may also play a role in the function of the mRNA.

Bacterial Proteins↗

Development of Stigmatella aurantiaca: effects of light and gene expression.

Stigmatella aurantiaca, a gliding, gram-negative bacterium, exhibits complex developmental changes upon starvation. In the light the cells aggregate and develop multicellular fruiting bodies with stalks and sporangia within 20 h. Between 23 and 27 h, sonication-resistant myxospores are synchronously formed inside the sporangia. On the other hand, in the dark, the cells aggregate and differentiate into myxospores between 13 and 27 h without forming stalks and sporangia. The pattern of protein synthesis during development in the light as well as in the dark was investigated. Three periods of synthesis, characterized by sharp increases and decreases in the rate of isotope incorporation into certain proteins, were distinguished. In the light these periods corresponded approximately to an early stage before the formation of aggregates, a middle period during which aggregates appeared and developed into fruiting bodies, and a late stage that corresponded to the appearance of myxospores. The pattern of protein synthesis in the dark could also be divided into three stages, but the middle stage was considerably shorter than in the light and showed diminished synthesis of certain proteins that were actively synthesized in the light. In particular, the synthesis of one protein was detected only in samples that developed in the light.

Bacterial Proteins↗

Patterns of protein production in Myxococcus xanthus during spore formation induced by glycerol, dimethyl sulfoxide, and phenethyl alcohol.

Spore formation of Myxococcus xanthus can occur not only on agar plates during fruiting body formation, but also in a liquid culture by simply adding glycerol, dimethyl sulfoxide, or phenethyl alcohol to the culture. This chemically-induced spore formation occurs synchronously and much faster than that occurring during fruiting body formation. Dramatic changes in patterns of protein synthesis were observed during chemically-induced spore formation, as had previously been observed during fruiting body formation (Inouye et al., Dev. Biol. 68:579-591, 1979). However, the production of protein S, one of the major development-specific proteins during fruiting body formation, was not detected at all, although protein U, another development-specific protein, was produced in a late stage of spore formation as in the case of fruiting body formation. This indicates that the control of the gene expression during chemically-induced spore formation is significantly different from that during fruiting body formation. It was also found that during spore formation, every cell seems to have a potential to form a spore regardless of its age, since smaller cells as well as larger cells separated by sucrose density gradient centrifugation could equally form spores upon the addition of glycerol. Patterns of protein synthesis were almost identical for all the three chemicals. However, the final yield of spores was significantly different depending upon the chemicals used. When phenethyl alcohol was added with glycerol or dimethyl sulfoxide, the final yields were determined by the multiple effect of the two chemicals added. This suggests that although these chemicals are able to induce the gene functions required for spore formation, they may have inhibitory effects on some of the gene functions or the processes of spore formation.

Bacterial Proteins↗

Secretion and membrane localization of proteins in Escherichia coli.

The envelope of Escherichia coli consists of two distinct membranes, the outer membrane and the cytoplasmic membrane. The space between the two membranes is called the periplasmic space, and each fraction contains its own specific proteins. In this review, it is discussed how proteins are localized in their final locations in the envelope. Proteins localized in the outer membrane and the periplasmic space as well as transmembranous proteins in the cytoplasmic membranes appear to be produced from their precursors which have peptide extensions of about 20 amino acid residues at the amino terminal ends. General features for the peptide extension are deduced from the known sequences of the peptide extensions, and, based on their known properties, a hypothesis (loop model) is proposed to explain the possible functions of the peptide extension during the mechanism of secretion across the cytoplasmic membrane.

Amino Acid Sequence↗

Purification of the messenger ribonucleic acid for the lipoprotein of the Escherichia coli outer membrane.

The mRNA for the lipoprotein of the Escherichia coli outer membrane has been purified to 85% homogeneity. The purification procedure involved phenol extraction, NaCl extraction, gel filtration on Sephadex G-100 and Sephadex G-200, and reversed-phase column chromatography on RPC-5. The purity of the final product was estimated to be 85% by analysis of the ribonuclease T1 fingerprint of the mRNA. The purified mRNA was able to direct the synthesis of cross-reactive material with antilipoprotein serum in both the E. coli and the wheat germ cell-free protein-synthesizing systems. The size of the mRNA was determined to be 8.2 S from its mobility in polyacrylamide--agrose gels. During the purification, two other RNA species, similar in size to the lipoprotein mRNA, were also isolated. Their sizes were determined to be 8.7 and 9.1 S. They both were inactive in an E. coli cell-free protein-synthesizing system.

Cell Membrane↗

Cerebellar malformations in prenatally X-irradiated rats: quantitative analysis and detailed description.

Pregnant WKA/Hok rats were exposed to 100 R or 200 R X-irradiation on one of gestation days 16 through 21. Offspring were killed at 60 days of age and the cerebellum was examined. The cerebellum of animals exposed to 200 R was slightly reduced in weight but not in width. The observed reduction in the dorsoventral length of the cerebellum was more evident when the X-irradiation was early in gestation. The anteroposterior length of the hemispheres increased following exposure to X-ray on days 16 through 19, and that of the vermis and paravermis decreased following treatment on days 17 through 21. Therefore, the anterior portions of hemispheres were situated anterior to the culmen in every 200 R group. Somewhat anteroposteriorly and horizontally directed lobules, as opposed to the normal transverse arrangement, were seen in the cerebellum of rats treated on day 16 or 17. Lobule contortion and fragmentation and an increased number of sublobules were striking in cases treated later. Histologically, ectopic Purkinje cells in the granule cell layer and white matter appeared following X-irradiation on day 20 or 21, but they were not found following earlier treatment. In the cerebellum of animals exposed to 100 R the reduction in size was mild and the folial abnormalities were rare, but the number of sublobules decreased.

Abnormalities, Radiation-Induced↗