PubMed Health⌕ Search

Biomedical subjects

M Iwabuchi

Publications and source records attributed to M Iwabuchi.

At least 127 records · Page 7Linked to original sources

ATP-dependent unwinding of the double helix and extensive supercoiling by Escherichia coli recA protein in the presence of topoisomerase.

recA protein, which is essential for genetic recombination in Escherichia coli, causes extensive unwinding of the double helix by an ATP-dependent reaction and accumulation of positive supercoiling in closed circular double-stranded DNA. Initiation of the extensive unwinding was largely dependent on homologous single-stranded DNA. Therefore, it is likely that the extensive unwinding is initiated mainly at the site of D-loops. "Nascent D-loops" in which the two DNA molecules did not interwind were also good initiation sites of extensive unwinding. When the concentration of Mg2+ was decreased from the standard conditions for D-loop formation (13 mM MgCl2; the higher Mg2+ condition) to the lower Mg2+ condition (1 to 2 mM MgCl2), extensive unwinding by recA protein was initiated very quickly in the absence of single-stranded DNA. Results showed that this single-stranded DNA-independent initiation of extensive unwinding (i) requires negative superhelicity of the double-stranded DNA and (ii) is a first order reaction with respect to the DNA. These observations suggest that, under the lower Mg2+ condition, the extensive unwinding starts at a transiently denatured site in the negative superhelical DNA. Once initiated, the unwinding by recA protein is propagated extensively, even under conditions that do not allow its initiation. Therefore, the propagation of unwinding is a processive reaction ("processive unwinding"). Previous studies indicated that recA protein promotes "distributive unwinding" of double helix which depends on single-stranded DNA. Therefore, recA protein promotes unwinding of the double helix by either of two distinct pathways. Stress caused by the processive unwinding could explain the dissociation of D-loops and reversible inactivation of the double-stranded DNA in a D-loop cycle.

Adenosine Triphosphate↗

The structural organization and DNA sequence of a wheat histone H4 gene.

Some wheat histone H4 genes have been cloned from a Charon 4 wheat genomic DNA library using sea urchin histone H4 DNA as a probe. DNA sequence analysis of a cloned gene showed that the deduced amino acid sequence of wheat histone H4 protein was identical to that of pea. The 5' end of wheat histone H4 mRNA was mapped on the cloned gene by the S1-procedure. Southern blotting analysis of the genomic DNA indicated that histone H4 genes were reiterated 100 to 125 times per hexaploid wheat genome.

Amino Acid Sequence↗

Nucleotide sequence of the transcriptional initiation region of Dictyostelium discoideum rRNA gene and comparison of the initiation regions of three lower eukaryotes' genes.

The 5' end of the rRNA precursor of D. discoideum was mapped on a cloned rDNA by S1 nuclease protection mapping, and the sequence of about 1240 nucleotides surrounding the transcriptional initiation site of the rRNA gene has been determined. Repeated sequences consisting of 16 nucleotides appeared in the region upstream from the initiation point. Comparison of the nucleotide sequences around the initiation site of rRNA genes in three lower eukaryotes, D. discoideum, Saccharomyces cerevisiae and Tetrahymena pyriformis, indicated that there was little similarity in the nontranscribed spacer regions, but in the transcribed spacer regions near the initiation point, very similar sequences consisting of 9 nucleotides were found.

Animals↗

Partial purification and characterization of DNA-dependent RNA polymerases I and II from cherry salmon (Oncorhynchus masou).

1. DNA-dependent RNA polymerases I and II were purified approx 3900- and 13,000-fold, respectively, from sonicated nuclear extract of cherry salmon (Oncorhynchus masou) liver by DEAE-Sephadex, heparin-Sepharose and DNA-cellulose column chromatography. 2. The purified RNA polymerases exhibited a requirement for four kinds of ribonucleoside 5'-triphosphates, an exogeneous template and divalent cation. 3. The activities of RNA polymerases I and II were inhibited by Actinomycin D (24 micrograms/ml) but not by Rifampicin (200 micrograms/ml). 4. RNA polymerase I preferred native DNA as template, while polymerase II preferred single-stranded DNA. 5. RNA polymerase II was inhibited by a low concentration of alpha-amanitin (0.02 micrograms/ml). RNA polymerase I was also inhibited by the relatively high concentration of alpha-amanitin (IC50 = 100 micrograms/ml and IC70 = 750 micrograms/ml). 6. RNA polymerases from cherry salmon exhibited a higher activity at low temperature than from rat liver.

Amanitins↗

The proposed Japanese TNM classification of primary liver carcinoma in infants and children.

The TNM classifications of neuroblastoma, nephroblastoma and soft tissue sarcoma were adopted at the International Conference for TNM Classification (UICC) held in May 1980. There is no TNM system under contemplation, however, for primary liver carcinoma in childhood. Accordingly, we have formulated the proposed Japanese TNM system for this carcinoma in children and examined its validity in 136 cases of hepatoblastoma seen in the listed 14 institutions. The basic policy of the Committee on the Japanese TNM Classification is not to include the resectability of the tumor and regional lymph nodes or any other status of the disease resulting from therapeutic intervention as a component of the pTNM system. This is a feature which makes our proposed system widely divergent from the accepted classification scheme for the three types of tumor cited above.

Adolescent↗

D-loop cycle. A circular reaction sequence which comprises formation and dissociation of D-loops and inactivation and reactivation of superhelical closed circular DNA promoted by recA protein of Escherichia coli.

Excess recA protein, a protein essential to general genetic recombination in Escherichia coli, promotes a sequence of formation and dissociation of D-loops from negative superhelical closed circular double-stranded DNA (form I DNA) and homologous single-stranded fragments in the presence of excess ATP, resulting in inactivation of the form I DNA without apparent damage to the DNA. The dissociation of D-loops is accompanied by hydrolysis of ATP to ADP that apparently depends on homologous DNA molecules (homology-dependent ATP hydrolysis). However, at a lower concentrations of ATP, we observed anomalous kinetics in the formation and dissociation of D-loops; as the concentration of ATP was decreased, there was a progressively smaller dissociation of D-loops and a faster resynthesis in the second phase, without changing the rate of the first formation of D-loops. This anomaly might suggest that, as the increase in the amount of ADP relative to that of ATP, dissociation form I DNA is stimulated before formation of D-loops is inhibited. We found that addition of ADP inhibited competitively both formation and dissociation of D-loops and that the latter process was more sensitive to the inhibition than was the former process. Addition of a sufficient amount of ADP to inhibit both formation and dissociation of D-loops, cessation of homology-dependent hydrolysis of ATP, or incubation at low temperature resulted in reactivation of form I DNA that had been inactivated by the sequence. In the presence of an ATP-regenerating system, we confirmed our previous result that limiting the amount of recA protein also causes anomalous kinetics in the formation and dissociation of D-loops. These observations indicate that the formation and dissociation of D-loops and the inactivation and reactivation of form I DNA make a circular reaction sequence.

Bacterial Proteins↗

Hydrolysis of ATP dependent on homologous double-stranded DNA and single-stranded fragments promoted by RecA protein of Escherichia coli.

RecA protein is essential to general genetic recombination in Escherichia coli. In the presence of ATP, a stoichiometric amount of recA protein forms D-loops from superhelical closed-circular DNA (form I DNA) and homologous single-stranded fragments, and subsequently dissociates the D-loops. Under appropriate conditions, the hydrolysis of ATP by recA protein depends on the presence of both double-stranded DNA and homologous single-stranded fragments (homology-dependent hydrolysis). In the presence of form I DNA, most of the homology-dependent hydrolysis of ATP by recA protein is related to the dissociation of D-loops rather than the formation of D-loops. RecA protein also promoted the homology-dependent hydrolysis of ATP in the presence of nicked-circular DNA (form II DNA), but unlike the case of form I DNA, this hydrolysis was associated with an increase in the amount of mature D-loops that were detected by the D-loop assay. When double-stranded DNA was superhelical, the homology-dependent hydrolysis of ATP continued at the same rate even after all the D-loops were dissociated. This correlates with our earlier observation that in the process of formation and dissociation of D-loops, form I DNA was converted to an inactive substrate without any apparent damage to the DNA, probably by the formation of a complex with recA protein. All of the observations described above can be explained by a model in which a common mechanism causes dissociation of D-loops from form I DNA, inactivation of form I DNA, and growth of D-loops in form II DNA. The mechanism might involve cooperative binding of recA protein to the duplex DNA from the site of the nascent D-loop, resulting in unidirectional unwinding of the duplex DNA.

Adenosine Triphosphate↗

Inhibitory effects of 3'deoxycytidine 5'-triphosphate and 3'-deoxyuridine 5'-triphosphate on DNA-dependent RNA polymerases I and II purified from Dictyostelium discoideum cells.

3'-Deoxycytidine 5'-triphosphate and 3'-deoxyuridine 5'-triphosphate were synthesized starting from cordycepin in good yield. The inhibitory effects of these nucleotides were examined in comparison with that of cordycepin 5'-triphosphate (3'-dATP) using purified DNA-dependent RNA polymerases I and II from Dictyostelium discoideum cells. Both nucleotide analogues strongly and competitively inhibited the incorporations of CTP and UTP into RNA by the RNA polymerases. The Km and Ki values for CTP and 3'-dCTP were 6.3 micro M and 3.0 micro M, respectively, and those for UTP and 3'-dUTP were 6.3 micro M and 2.0 micro M, respectively. These two analogues will be useful in studies at the molecular level on the relationship of template and substrate in RNA synthesis with chromatin, isolated nuclei or permeable cells, because they do not have any effect on poly (rA) synthesis.

DNA-Directed RNA Polymerases↗

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

Animals↗

Template specificity of DNA-dependent RNA polymerase I and II for synthetic polynucleotides during development of the cellular slime mold Dictyostelium discoideum.

The template specificity of DNA-dependent RNA polymerases I and II (ribonucleoside 5'-triphosphate : RNA nucleotidyltransferase [EC 2.7.7.6]) of Dictyostelium discoideum was investigated with several synthetic polynucleotides at three different stages of development. Both the enzymes exhibited several common characteristics for some templates, and distinctly different properties for other ones. Of single-stranded homopolymers, the strands of pyrimidine nucleotides were much transcribed in the order of poly(dC) greater than poly(dT). The double-stranded homopolymers, poly(dA). poly(dT)) and poly(dG).poly(dC) were transcribed asymmetrically, the pyrimidine-containing strand being preferentially read. Transcription of double-stranded alternating copolymers, poly([d(A-T)].poly[d(A-T)] and poly[d(G-C)].poly[d(g-C)] occurred to some extent. Except for poly(rC), all of the single-stranded ribonucleotide homopolymers were extremely poor as templates. The polynucleotides containing thymidine were more efficient templates for polymerase I than polymerase II. The enzyme activities of the two polymerases were more or less variable with some polynucleotides among three stages of development, suggesting the possibility that D. discoideum RNA polymerases tend to change their template specificity during development.

DNA-Directed RNA Polymerases↗

Aminopeptidase activities on the surface of mammalian cells and their alterations associated with transformation.

Activities of various hydrolytic enzymes were determined in rat organ homogenates and on the surface of cells from various sources, i.e., tumor cell strains, primary cultured cells, normal cells, and their transformants. Alanine, leucine, methionine, phenylalanine, and glycyl-proline aminopeptidases and esterase showed relatively high activities in all these organs and cells. In the kidney homogenate the aminopeptidase A activity was higher in other organs; i.e., the aminopeptidase A activity was lower than that of aminopeptidase B. Normal cells derived from kidneys showed the kidney-type pattern of amino-peptidases A and B on the surface of cells, whereas tumor cells from various origins were of another organ type. When cultured mouse fibroblast strain C3H2K and rat fibroblast strain 3Y1 cells were transformed by SV40 or by a ts A mutant and maintained at permissive temperature, aminopeptidase A activity was drastically decreased, and the ratio of aminopeptidase A to aminopeptidase B was reduced to the levels of tumor cells. If the ts A mutant-transformed cells were grown at the restrictive temperature, the ratio approached that of normal cells. In normal cells, however, cultivation at high or low temperature did not cause any change of the activities.

Aminopeptidases↗