PubMed HealthSearch

Biomedical subjects

M Kusuda

Publications and source records attributed to M Kusuda.

At least 19 recordsLinked to original sources

A simple method to assess osteoclast-mediated bone resorption using unfractionated bone cells.

To determine osteoclastic bone resorption we established a simple assay system in which unfractionated cells obtained from femora of 13-day-old mice were cultured on a dentine slice and the number of osteoclasts and their induced pit area on the slices were measured. When the bone cells (1 x 10(5) cells/dentine slice) were cultured in the presence of 1,25-dihydroxyvitamin D3 [1,25(OH)2D3] or human parathyroid hormone (hPTH) for 4 days, at which time newly-formed osteoclasts were not detected, the pit area was dose-dependently increased, being a 4.3- or 4.1-fold respective increase over the control at a 10(-8) M concentration of hormones. Chick calcitonin (cCT) inhibited the osteoclastic bone resorption induced by either of these hormones. cCT alone also suppressed the bone resorption by the cells (3 x 10(5) cells/dentine slice). These findings indicate that 1,25(OH)2D3 or hPTH may mainly activate pre-existing osteoclasts, resulting in increased bone resorption, and that cCT may suppress this osteoclastic activity. When 1,25(OH)2D3 or hPTH was added to the cells pre-cultured in factor-free medium for 6 days, at which time pre-existing osteoclasts had almost degenerated, new osteoclasts were formed, resulting in an increase in pit formation. Thus this system is a useful method which could more sensitively evaluate the effects of hormones or factors on osteoclast formation and activation than other previous systems.

Animals

Murine recombinant leukemia inhibitory factor modulates inhibitory effect of 1,25 dihydroxyvitamin D3 on alkaline phosphatase activity in MC3T3-E1 cells.

We demonstrated murine leukemia inhibitory factor (mLIF) mRNA in osteoblastic MC3T3-E1 cells, but not mLIF in their conditioned medium. Recombinant mLIF had an inhibitory effect on alkaline phosphatase (ALP) activity, but not on DNA synthesis, in these mLIF-free cells. This inhibitory effect was not prostaglandin E2 dependent. mLIF also modulated the inhibitory effect of 1,25 dihydroxyvitamin D3 [1,25(OH)2D3] on ALP activity, partly via down regulation of 1,25(OH)2D3 binding sites. These results suggest that LIF may play a role in regulating osteoblast differentiation.

Alkaline Phosphatase

Expression of Ia antigen by ocular tissues of mice treated with interferon gamma.

Intraperitoneal injections of interferon gamma (IFN-gamma) induced or enhanced the expression of Ia antigen by selected murine ocular tissues. In contrast, topical application of this lymphokine had no effect. Ia antigen expression was noted in most cellular components of the conjunctiva, iris, ciliary body, choroid and sclera of treated mice. Intense staining was also found in stromal cells of the cornea, but no Ia reactivity was detected in the corneal epithelium. The lack of staining in the corneal epithelium is in contrast to the strong reactivity in the adjacent conjunctival epithelium, as well as in the skin epithelium. There was no increase in the number of Langerhans cells in the peripheral cornea and limbus, or in their intensity of staining with the anti Ia antibodies. The pattern of Ia expression in ocular tissues of mice treated with IFN-gamma is similar to that of rats with experimental autoimmune uveoretinitis (EAU) except that Ia is expressed more regularly and with higher intensity by the retinal vascular endothelium of rats with EAU than by that of IFN-gamma-treated mice. The findings in the current study thus support the notion that IFN-gamma may be involved in immune-mediated inflammation in the eye.

Animals

Cryopexy enhances experimental autoimmune uveoretinitis (EAU) in rats.

Treatment of rat eyes with cryopexy enhanced the development of experimental autoimmune uveitis (EAU) in these eyes. The enhancement of EAU by cryopexy was particularly pronounced when the disease was induced by active immunization in rats of a low responder strain (Wistar Furth), or by adoptive transfer with lymphocytes sensitized against S-antigen. The disease enhancement was expressed by earlier onset of clinical symptoms and by more severe inflammatory changes. Histological examination of cryopexy-treated eyes showed focal necrosis and inflammation, confined to the affected sites. Immunohistochemical analysis of the inflammatory infiltration revealed it consists mainly of macrophages and T-lymphocytes of the helper and suppressor subsets. In addition, increased expression of class II antigens was observed in affected areas, on both inflammatory and resident ocular cells. Using electron microscopy and Evans blue angiography we could show breakdown of the blood-retinal barrier at the treated sites. Histological examination of eyes with EAU following cryopexy showed localization of the early inflammation at the injured site. The data are interpreted to suggest that the enhanced EAU in cryopexy-treated eyes is mainly due to the breakdown of the blood-retinal barrier, the accumulation of lymphoid cells and the increased expression of class II antigens, which facilitates antigen presentation.

Animals

The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

Base Sequence

The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and shows strong homology with those from flowering plants.

Base Sequence

Infertility and metroplasty.

Various techniques of metroplasty were performed in 32 cases of double uterus. In these patients the fetal survival rate before the operation was nil, whereas post-operatively it reached as high as 92.6%. Strassmann's operation was carried out in 16 cases, Jones & Jones's modified method in 12 cases and Tompkins's operation in 4 cases. The merits and demerits and the applicability of each technique and the various types of uterine malformation are discussed. It is concluded that a correct diagnosis of uterine malformation can only be established by a combination of precise HSG with direct macroscopical observation of uterine body. The Strassmann transverse incision is well suited for a bicornuate uterus, and Jones & Jones's wedge-shaped fundal resection for a partial septate uterus. The postoperative deformation in the fundus uteri is most frequently seen after the application of Strassmann's method, and is much less common with the modified method of Jones & Jones. Metroplasty can be applied in such cases of uterine malformation as when primary sterility is complained of but where any other cause for sterility is ruled out or is deemed to be corrected. Maximum care should be taken to prevent postoperative adhesion. Three months is considered to be a sufficient period for postoperative contraception. The mode of delivery depends on the individual case, though cesarean section is recommended.

Abortion, Habitual

Induction of LH surge with estradiol benzoate and its clinical significance in anovulatory women.

In order to investigate the hypothalamic function of anovulatory women serial determinations of the serum gonadotropins (LH and FSH) were made over a period of 120 h following the intramuscular injection of 1 mg of estradiol benzoate (E.B.). Ten women with normal menstrual cycles and 57 anovulatory women were subjected to this study. The positive release of LH in serum (exceeding at least 150% of basal level) in response to E.B. was noted in follicular phase of the cycles, but not in luteal phase, and in 31 of 57 patients the release came between 48 to 96 h after the E.B. injection. The LH surge after E.B. injection was difficult to provoke when the basal serum LH and estradiol (E2) levels were low: less than 10 mIU/ml and 50 pg/ml, respectively. Thirteen of 27 patients, who showed LH surge, ovulated because of Clomid. Only three of 17 patients, who did not show LH surge, ovulated as a response to Clomid. Ten of 14 patients, who showed LH surge after E.B. but did not ovulate after Clomid, revealed a polycystic ovarian disease (PCO), and the responsiveness to both E.B. and Clomid improved after wedge-resection of the ovaries. These results suggest that the serum E2 level is closely correlated to the ability for LH-RH production in the hypothalamic "surge center," and that the E.B. provocation test is useful for investigating the hypothalamic function of anovulatory women and for diagnosing preoperatively the PCO resistant to Clomid treatment.

Adult

[Studies on the classification of endometriosis].

A new classification system of endometriosis proposed by the American Fertility Society (AFS classification) was utilized to categorize patients with endometriosis after surgical treatment and the following results were obtained. 1. AFS classification system was useful to categorize patients with endometriosis, because of a simple and objective point system. 2. There were discrepancies in categorized patients between AFS system and a system proposed by Acosta et al. (Acosta's system). One-third of patients categorized as "Severe" by Acosta's system was classified to be "Moderate" by AFS system. These discrepancies occurred when lesion of endometriosis was just restricted within ovaries. 3. Conception was reduced once ovaries were involved and fecundability rate was significantly reduced if ovarian endometrioma was greater than 3cm in diameter. 4. Acosta's system revealed differences among fecundability rate among the different categories, however, AFS system could not demonstrate a direct correlation between the categories of endometriosis and fecundability rate.

Adult

The nucleotide sequences of two tRNAAsn genes from tobacco chloroplasts.

Recombinant plasmids which contain EcoRI fragments of tobacco chloroplast DNA carrying tRNA genes were constructed. Plasmids pTC211 and pTC293 contain the base sequences for tRNAAsn in their 1.4 and 1.1 Md EcoRI fragments, respectively. These two tRNA sequences are identical and are; 5'-TCCTCAGTAGCTCAGTGGTAGAGCGGTCGGCTGTTAACCGATTGGTCGTAGGTTCGAATCCTACTTGGGGAG-3'. Each tRNAAsn gene is located at about 0.9 kb apart from the distal end of each 5S rRNA gene and is coded for by the DNA strand opposite from that of the rRNA genes.

Aspartate-tRNA Ligase

Hypothalamic function of secondary anovulatory women.

In order to investigate the hypothalamic function of the women suffering from ovulatory defect, serial determinations of the serum gonadotropins (LH and FSH) were made over a period of 120 hrs following the intramuscular injection of estradiol benzoate (E.B.) 1 mg. Ten normal cycling women and 57 anovulatory women, excluding premature ovarian failure, were subjected to this study. The positive release of LH in serum (exceeds at least 150% of basal level) to E. B. were noted in follicular phase of the normal cycles, but not in luteal phase, and in 31 of 57 anovulatory women the release occurred between 48 to 96 hrs after the E.B. injection. The LH surge after EB. was difficult to provoke when the basal serum LH and estradiol (E2) levels were low as less than 10 mIU/ml and 50 pg/ml, respectively. Thirteen of 27 women, who showed LH surge, ovulated by Clomid. Only 3 of 17 women, who did not show LH surge to E.B., ovulated as a response to Clomid. Ten of 14 cases, who showed LH surge to E.B. but not ovulated by Clomid, revealed polycystic ovarian disease (PCO), and the responsiveness to E.B. and Clomid improved after wedge-resection of the ovaries. These results suggest that the serum E2 level is closely correlated with the ability for LH-RH production in hypothalamic "surge center" either primarily or secondarily, and that E.B. provocation test is useful to investigate the hypothalamic function of anovulatory patients and to preoperatively diagnose the PCO patients refractory to Clomid treatment.

Adult

Detection of subclinical abortion in infertile women by beta-hCG radioimmunoassay.

Serum hCG was measured by specific beta-hCG radioimmunoassay during the late luteal phase in 58 infertile women recording the basal body temperature. As control, serum hCG was also measured during the 5th to 17th day after the basal body temperature shift in 18 normal pregnancy. In all normal pregnancy cases serum hCG was detected after the 9th day from basal temperature shift. Serum hCG was detected during the late luteal phase in 6 cases, including 2 cases succeeded in pregnancy in corresponding cycle, out of 58 infertile women. In spite of the hCG detection, the hyperthermic phase on BBT chart was not significantly prolonged in remaining 4 cases, in which the next menses took place as usual. Thus, so called subclinical abortion was suspected in these 4 cycles. This result suggests subclinical abortion might occur in infertile women. When hCG is detected during the late luteal phase, intensive treatment for the defective luteal function may salvage the endangered pregnancy. Since the incidence of hCG detection in this study was rather smaller than the previous reports, the major portion of causes of infertility might exist earlier or around the time of implantation of fertilized ovum.

Abortion, Spontaneous