PubMed Health⌕ Search

Biomedical subjects

M Majumdar

Publications and source records attributed to M Majumdar.

18 recordsLinked to original sources
PubMed2002

Hyaluronan binding protein 1 (HABP1)/C1QBP/p32 is an endogenous substrate for MAP kinase and is translocated to the nucleus upon mitogenic stimulation.

The role of hyaluronan binding protein 1 (HABP1) in cell signaling was investigated and in vitro kinase assay demonstrated that it is a substrate for MAP kinase. Phosphorylation of endogenous HABP1 was also observed following treatment of J774 cells with PMA. HABP1 was coimmunoprecipitated with activated ERK, confirming their physical interaction in the cellular context. Upon PMA stimulation of normal rat fibroblast (F111) and transformed (HeLa) cells, the HABP1 level in the cytoplasm gradually decreased with a parallel increase in the nucleus. In HeLa cells, within 6 h of PMA treatment, HABP1 was completely translocated to the nucleus, which was prevented by PD98059, a selective inhibitor of ERK. We also observed that the nuclear translocation of HABP1 is concurrent with that of ERK, suggesting that ERK activation is a requirement for the translocation of HABP1. It is thus established for the first time that HABP1 is a substrate for ERK and an integral part of the MAP kinase cascade.

Active Transport, Cell Nucleus↗
PubMed2002

Evidence for the presence of HABP1 pseudogene in multiple locations of mammalian genome.

The gene encoding hyaluronan-binding protein 1 (HABP1) is expressed ubiquitously in different rat tissues, and is present in eukaryotic species from yeast to humans. Fluorescence in situ hybridization indicates that this is localized in human chromosome 17p13.3. Here, we report the presence of homologous sequences of HABP1 cDNA, termed processed HABP1 pseudogene in humans. This is concluded from an additional PCR product of ~0.5 kb, along with the expected band at approximately 5 kb as observed by PCR amplification of human genomic DNA with HABP1-specific primers. Partial sequencing of the 5-kb PCR product and comparison of the HABP1 cDNA with the sequence obtained from Genbank accession number AC004148 indicated that the HABP1 gene is comprised of six exons and five introns. The 0.5-kb additional PCR product was confirmed to be homologous to HABP1 cDNA by southern hybridization, sequencing, and by a sequence homology search. Search analysis with HABP1 cDNA sequence further revealed the presence of similar sequence in chromosomes 21 and 11, which could generate ~0.5 kb with the primers used. In this report, we describe the presence of several copies of the pseudogene of HABP1 spread over different chromosomes that vary in length and similarity to the HABP1 cDNA sequence. These are 1013 bp in chromosome 21 with 85.4% similarity, 1071 bp in chromosome 11 with 87.2% similarity, 818 bp in chromosome 15 with 82.3% similarity, and 323 bp in chromosome 4 with 84% similarity to HABP1 cDNA. We have also identified similar HABP1 pseudogenes in the rat and mouse genome. The human pseudogene sequence of HABP1 possesses a 10 base pair direct repeat of "AGAAAAATAA" in chromosome 21, a 12-bp direct repeat of "AG/CAAATTA/CAA/TTA" in chromosome 4, a 8-bp direct repeat of "ACAAAG/TCT" in chromosome 15. In the case of chromosome 11, there is an inverted repeat of "AGCCTGGGCGACAGAGCGAGA" ~50 bp upstream of the HABP1 pseudogene sequence. All of the HABP1 pseudogene sequences lack 5' promoter sequence and possess multiple mutations leading to the insertion of premature stop codons in all three reading frames. Rat and mouse homologs of the HABP1 pseudogene also contain multiple mutations, leading to the insertion of premature stop codons confirming the identity of a processed pseudogene.

Animals↗
PubMed1999

A rho exchange factor mediates thrombin and Galpha(12)-induced cytoskeletal responses.

Thrombin induces astrocytoma cell rounding through a Rho-dependent pathway (Majumdar, M., Seasholtz, T. M., Goldstein, D., de Lanerolle, P., and Brown, J. H. (1998) J. Biol. Chem. 273, 10099-10106). The involvement of the G(12) family of G proteins and the role of specific Rho exchange factors in transducing signals from the thrombin receptor to Rho-dependent cytoskeletal responses was examined. Microinjection of cDNAs for activated Galpha(12) or Galpha(13) induced cell rounding, and antibodies to Galpha(12) or Galpha(13) blocked the response to thrombin. In contrast, activation or inhibition of Galpha(q) function had relatively little effect. The cytoskeletal response to Galpha(12) was inhibited by microinjection of C3 exoenzyme, indicating Rho dependence. Two Rho-specific guanine nucleotide exchange factors (GEFs), oncogenic lbc and p115, increased the percentage of rounded cells 4-5-fold, and this was inhibited by C3. Mutant GEFs lacking the Dbl homology (DH) domain required for exchange factor activity failed to induce cell rounding. However, the DH mutants of lbc and p115 were efficacious inhibitors of rounding induced by thrombin or Galpha(12). The effects of lbc were dependent on an intact pleckstrin homology domain, which may be required for appropriate targeting of the Rho-GEF. These findings identify the Galpha(12) protein family as transducers of thrombin signaling to the cytoskeleton and provide the first evidence that a Rho-GEF transduces signals between G protein-coupled receptors and Rho-mediated cytoskeletal responses.

Cell Size↗
PubMed1999

Rho and Rho kinase mediate thrombin-stimulated vascular smooth muscle cell DNA synthesis and migration.

Aberrant regulation of smooth muscle cell proliferation and migration is associated with the pathophysiology of vascular disorders such as hypertension, atherosclerosis, restenosis, and graft rejection. To elucidate molecular mechanisms that regulate proliferation and migration of vascular smooth muscle cells, we determined whether signaling through the small G protein Rho is involved in thrombin- and phenylephrine-stimulated proliferation and migration of rat aortic smooth muscle cells (RASMCs). Thrombin and the thrombin peptide SFLLRNP stimulated DNA synthesis of RASMCs as measured by [3H]thymidine incorporation. Both ligands also increased cell migration as measured by the Boyden chamber method. L-Phenylephrine failed to induce either of these responses but increased inositol phosphate accumulation and mitogen-activated protein kinase activation in these cells, which indicated that the cells were responsive to alpha1-adrenergic stimulation. The C3 exoenzyme, which ADP-ribosylates and inactivates Rho, fully inhibited both thrombin-stimulated proliferation and migration but had no effect on inositol phosphate accumulation. In addition, Y-27632, an inhibitor of the Rho effector p160ROCK/Rho kinase, decreased thrombin-stimulated DNA synthesis and migration. To directly examine Rho activation, Rho-[35S]GTPgammaS binding was measured. The addition of the thrombin peptide SFLLRNP, but not phenylephrine, to RASMC lysates resulted in a significant increase in Rho-[35S]GTPgammaS binding. Thrombin and SFLLRNP, but not phenylephrine, also increased membrane-associated Rho in intact RASMCs, consistent with selective activation of Rho by thrombin. These results indicate that thrombin activates Rho in RASMCs and establish Rho as a critical mediator of thrombin receptor effects on DNA synthesis and cell migration in these cells.

Adenosine Diphosphate Ribose↗
PubMed1998

Requirement for Rho-mediated myosin light chain phosphorylation in thrombin-stimulated cell rounding and its dissociation from mitogenesis.

Thrombin treatment causes a dose-dependent rounding of 1321N1 astrocytoma cells. This cytoskeletal response is rapid, peaking 2 h after thrombin stimulation, and reverses by 50% after 24 h. The thrombin receptor peptide SFLLRNP also induces cell rounding, whereas other G protein-linked receptor agonists such as carbachol, lysophosphatidic acid, or bradykinin fail to do so. Results of studies using pharmacological inhibitors do not support a requirement for phosphatidylinositol 3-kinase, mitogen-activated protein kinase, or Ca2+ mobilization in this response. Inhibition of protein kinase C or tyrosine kinase produces minimal blockade. Pertussis toxin treatment is also without effect. However, thrombin-induced rounding is fully blocked by the C3 toxin from Clostridium botulinum, which specifically ADP-ribosylates and inactivates the small G protein Rho. Thrombin also leads to a rapid, 2.4-fold increase in 32P incorporation into myosin light chain while carbachol does not. Myosin phosphorylation, like cell rounding is inhibited by inactivation of Rho with C3 exoenzyme, suggesting that myosin phosphorylation is necessary for this cytoskeletal response. This is supported by the observation that thrombin-induced rounding is also blocked by the myosin light chain kinase inhibitor KT5926. However, treatment with KT5926 fails to inhibit mitogenesis. Thus, cell rounding is not prerequisite to thrombin-induced DNA synthesis. We conclude that stimulation of the heterotrimeric G protein-coupled thrombin receptor in 1321N1 cells activates Rho-dependent pathways for both DNA synthesis and cell rounding, the cytoskeletal response being mediated in part through increases in myosin phosphorylation.

Astrocytoma↗
PubMed1998

Signaling through the interaction of membrane-restricted stem cell factor and c-kit receptor tyrosine kinase: genetic evidence for a differential role in erythropoiesis.

Mutations of the receptor tyrosine kinase c-kit or its ligand stem cell factor (SCF), which is encoded as a soluble and membrane-associated protein by the Steel gene in mice, lead to deficiencies of germ cells, melanocytes, and hematopoiesis, including the erythroid lineage. In the present study, we have used genetic methods to study the role of membrane or soluble presentation of SCF in hematopoiesis. Bone marrow-derived stromal cells expressing only a membrane-restricted (MR) isoform of SCF induced an elevated and sustained tyrosine phosphorylation of both c-kit and erythropoietin receptor (EPO-R) and significantly greater proliferation of an erythrocytic progenitor cell line compared with stromal cells expressing soluble SCF. Transgene expression of MR-SCF in Steel-dickie (Sld) mutants resulted in a significant improvement in the production of red blood cells, bone marrow hypoplasia, and runting. In contrast, overexpression of the full-length soluble form of SCF transgene had no effect on either red blood cell production or runting but corrected the myeloid progenitor cell deficiency seen in these mutants. These data provide the first evidence of differential functions of SCF isoforms in vivo and suggest an abnormal signaling mechanism as the cause of the severe anemia seen in mutants of the Sl gene.

Animals↗
PubMed1994

Insulin receptor substrate 1 is required for insulin-mediated mitogenic signal transduction.

Insulin treatment of mammalian cells immediately stimulates the tyrosine phosphorylation of a cellular protein of 185 kDa referred to as pp185 or IRS-1 (insulin receptor substrate 1). The potential role of the IRS-1 protein in insulin signaling has been examined by microinjecting affinity-purified antibodies into living cells. Stably transfected Rat-1 fibroblasts, which overexpress the human insulin receptor, were microinjected and subsequently stimulated with insulin or other growth factors. Progression through the cell cycle was monitored by using a single-cell assay, which employs bromodeoxyuridine labeling of DNA and analysis with immunofluorescence microscopy. Microinjection of anti-IRS-1 antibody completely inhibited incorporation of bromodeoxyuridine into the nuclei of cells stimulated with insulin or insulin-like growth factor I but did not affect cells stimulated with serum or a variety of purified growth factors. These studies indicate that IRS-1 is a critical component of the insulin and insulin-like growth factor I signaling pathways, which lead to DNA synthesis and cell growth.

Amino Acid Sequence↗
PubMed1990

Contraceptive efficacy of tamoxifen in female hamsters.

Systemic administration of tamoxifen (trans-1-(4-B-dimethylaminoethoxyphenyl)-1,2-diphenyl-but-1-ene), an antiestrogen, at a dose level of 2 mg/kg body weight on days 1, 2 and 3 post-coitum (p.c.) intercepts pregnancy during the peri-implantation period in 70-80% of hamsters. Significant alterations in the circulating levels of estradiol and progesterone were accompanied by the abolition of peak activities of various uterine lysosomal enzymes in the treated animals. The present study, therefore, suggests that estrogen plays a crucial role during the process of ovum-implantation in hamsters, and tamoxifen displays an interceptive role in this species.

Animals↗
PubMed1989

RB virus: a strain of Friend virus that produces a 'Friend virus-like' disease in Fv-2rr mice.

RB virus is a newly derived strain of Friend virus that was adapted to produce a 'Friend-like' disease in mice that are genetically resistant to wild-type Friend virus. RB virus was produced by passing high titers of the wild-type Friend virus (Lilly-Steeves polycythemia-producing strain) through adult Fv-2rr mice. Titration of the defective spleen focus-forming virus indicated RB virus infected similar numbers of Fv-2ss or Fv-2rr target cells. Analysis of the spleens from mice infected with RB virus indicated that RB induced the early stage of Friend disease (erythroid proliferation) in both Fv-2rr and Fv-2ss mice. Fv-2ss mice infected with RB virus developed the classical Friend disease within 3 weeks. In contrast, the percentage of Fv-2rr mice developing the 'Friend-like' disease after infection with RB virus never exceeded 60%. The latency period of RBV in Fv-2rr mice was strain dependent. D2.R16 (Fv-2rr) developed the syndrome more rapidly than C57BL/6 (Fv-2rr). RB virus retained the capacity to transform erythroprogenitor cells from both Fv-2ss and Fv-2rr animals. Cells infected with RB virus consistently produced a modified SFFV envelope protein, gp48.

Animals↗
PubMed1986

Immunochemical properties of the lipopolysaccharide O-antigen of Vibrio cholerae O1 in relation to its chemical structure.

D-Glucuronic acid and D-glucosamine have an immunodominant role in the lipopolysaccharide (LPS) O-antigen of both the Ogawa and the Inaba subtypes of Vibrio cholerae O1. This was evident from the pronounced inhibitory effect on the LPS precipitin reaction demonstrated by these monosaccharides and by oligosaccharides containing either of them which were isolated from LPS hydrolysate. There was a considerable decrease in the antibody-combining capacity of chemically modified LPS in which the carboxyl group of the glucuronic acid had been reduced. Similarly, on deamination, the O-specific polysaccharide fraction of the LPS molecule from both subtypes completely lost the ability to precipitate the LPS antibody.

Antigens, Bacterial↗
PubMedDate not supplied

Mycetoma caused by a new red grain mycetoma agent in two members of a family.

An 18-year-old woman from rural West Bengal was affected with mycetoma involving her neck, back, and chest. After an interval of eight years, her younger brother developed mycetoma on his left arm. No history of trauma or immune deficiency was present in either case. By microscopic examination of sinus-discharged materials from both the cases, identical rusty red, hard grains were demonstrated. Soluble red pigment-producing colonies grew in Sabouraud dextrose-agar medium. Isolates were positive for casein hydrolysis and negative for hydrolysis test of xanthine, hypoxanthine, tyrosine, and nitrate reduction. Thus it differed from the only known red grain mycetoma agent, Actinomadura pelletieri and was provisionally identified as Actinomadura vinacea. Familial affection in mycetoma, that too caused by a new agent, is reported here for its uniqueness.

Adolescent↗