PubMed Health⌕ Search

Biomedical subjects

M Merchlinsky

Publications and source records attributed to M Merchlinsky.

15 recordsLinked to original sources

Vaccinia virus-bacteriophage T7 expression vector for complementation analysis of late gene processes.

A vaccinia virus-bacteriophage T7 RNA polymerase hybrid transient expression vector has been developed for complementation analysis of late gene functions in vaccinia virus. The conditionally defective virus ts21 was modified to express the bacteriophage T7 RNA polymerase. The derived virus, vtsT7, was conditionally defective in viral late gene expression but produced high levels of a target protein under the control of a T7 promoter at non-permissive temperatures. The level of beta-galactosidase expression under the control of a T7 promoter was slightly lower in vtsT7 infections than those with the prototypical T7 RNA polymerase vector vTF7.3. However, the levels of expression for the human immunodeficiency virus envelope gene, a protein which undergoes post-translational modification, was slightly higher in vtsT7 infections, suggesting that some proteins may be expressed better in the absence of vaccinia virus late gene expression. Infections using vtsT7 at a low m.o.i. at 39 degrees C resulted in the accumulation of high molecular mass, non-linear replicative intermediates of vaccinia virus DNA replication and high levels of expression of a transfected gene proximal to a T7 promoter. The virus vtsT7 provides a means for the analysis of potential trans-acting factors participating in vaccinia virus late processes such as resolution of DNA replicative intermediates.

Bacteriophage T7↗

Vaccinia virus WR gene A5L is required for morphogenesis of mature virions.

The vaccinia virus WR A5L open reading frame (corresponding to open reading frame A4L in vaccinia virus Copenhagen) encodes an immunodominant late protein found in the core of the vaccinia virion. To investigate the role of this protein in vaccinia virus replication, we have constructed a recombinant virus, vA5Li, in which the endogenous gene has been deleted and an inducible copy of the A5 gene dependent on isopropyl-beta-D-thiogalactopyranoside (IPTG) for expression has been inserted into the genome. In the absence of inducer, the yield of infectious virus was dramatically reduced. However, DNA synthesis and processing, viral protein expression (except for A5), and early stages in virion formation were indistinguishable from the analogous steps in a normal infection. Electron microscopy revealed that the major vaccinia virus structural form present in cells infected with vA5Li in the absence of inducer was immature virions. Viral particles were purified from vA5Li-infected cells in the presence and absence of inducer. Both particles contained viral DNA and the full complement of viral proteins, except for A5, which was missing from particles prepared in the absence of inducer. The particles prepared in the presence of IPTG were more infectious than those prepared in its absence. The A5 protein appears to be required for the immature virion to form the brick-shaped intracellular mature virion.

Cell Line↗

Marker rescue of the host range restriction defects of modified vaccinia virus Ankara.

The severely attenuated and host range (HR) restricted modified vaccinia virus Ankara (MVA) was derived by >500 passages in chick embryo fibroblasts, during which multiple deletions and mutations occurred. To determine the basis of the HR defect, we prepared cosmids from the parental vaccinia virus Ankara genome and transfected them into nonpermissive monkey BS-C-1 cells that had been infected with MVA. Recombinant viruses that formed macroscopic plaques were detected after transfections with DNA segments that mapped near the left end of the viral genome. Plaque-forming viruses, generated by transfections with four individual cosmids and one pair of minimally overlapping cosmids, were purified, and their HRs were evaluated in BS-C-1 cells, rabbit RK-13 cells, and human HeLa, MRC-5, and A549 cells. The acquisition of the K1L and SPI-1 HR genes and the repair of large deletions were determined by polymerase chain reaction or pulse-field gel electrophoresis of NotI restriction enzyme digests of genomic DNA. The following results indicated the presence of previously unrecognized vaccinia virus HR genes: (1) the major mutations that restrict HR are within the left end of the MVA genome because the phenotypes of some recombinants approached that of the parental virus, (2) acquisition of the K1L gene correlated with the ability of recombinant viruses to propagate in RK-13 cells but did not enhance replication in human or monkey cell lines, (3) acquisition of the SPI-1 gene correlated with virus propagation in A549 cells but not with the extent of virus spread in monkey or other human cell lines, (4) there are at least two impaired HR genes because rescue occurred with nonoverlapping or minimally overlapping cosmids and recombinant viruses with intermediate HRs were isolated, and (5) at least one of the new HR genes did not map within any of the major deletions because the size of the left terminal NotI fragment was not appreciably altered in some recombinant viruses.

Animals↗

DNA packaging mutant: repression of the vaccinia virus A32 gene results in noninfectious, DNA-deficient, spherical, enveloped particles.

The vaccinia virus A32 open reading frame was predicted to encode a protein with a nucleoside triphosphate-binding motif and a mass of 34 kDa. To investigate the role of this protein, we constructed a mutant in which the original A32 gene was replaced by an inducible copy. The recombinant virus, vA32i, has a conditional lethal phenotype: infectious virus formation was dependent on isopropyl-beta-D-thiogalactopyranoside (IPTG). Under nonpermissive conditions, the mutant synthesized early- and late-stage viral proteins, as well as viral DNA that was processed into unit-length genomes. Electron microscopy of cells infected in the absence of IPTG revealed normal-appearing crescents and immature virus particles but very few with nucleoids. Instead of brick-shaped mature particles with defined core structures, there were numerous electron-dense, spherical particles. Some of these spherical particles were wrapped with cisternal membranes, analogous to intracellular and extracellular enveloped virions. Mutant viral particles, purified by sucrose density gradient centrifugation, had low infectivity and transcriptional activity, and the majority were spherical and lacked DNA. Nevertheless, the particle preparation contained representative membrane proteins, cleaved and uncleaved core proteins, the viral RNA polymerase, the early transcription factor and several enzymes, suggesting that incorporation of these components is not strictly coupled to DNA packaging.

DNA, Viral↗

Construction and characterization of vaccinia direct ligation vectors.

Poxvirus vectors are extensively used as expression vehicles for protein and antigen expression in eukaryotic cells. Customarily, the foreign DNA is introduced into the poxvirus genome by homologous recombination. An alternative method using direct ligation vectors has been used to efficiently construct chimeric genomes in situations not readily amenable for homologous recombination. We describe the construction and characterization of a new set of direct ligation vectors designed to be universally applicable for the generation of chimeric vaccinia genomes. These vectors contain the pair of unique restriction sites NotI and ApaI to eliminate religation of poxvirus arms and fix the orientation of the insert DNA behind strongly expressing constitutive vaccinia promoters. The insertion cassette has been placed at the beginning of the thymidine kinase gene in vaccinia to use drug selection in the isolation of recombinants. These viruses provide a set of universally applicable direct ligation poxvirus cloning vectors, extending the utility of poxvirus vectors for construction and expression of complex libraries.

Animals↗

Introduction of foreign DNA into the vaccinia virus genome by in vitro ligation: recombination-independent selectable cloning vectors.

Homologous recombination has been the exclusive means of introducing foreign DNA into the genomes of large DNA viruses. Here we demonstrate that direct in vitro ligation can be used to efficiently insert DNA fragments of up to 26,000 bp into the genome of vaccinia virus modified to contain a single NotI site either in the Escherichia coli lacZ gene or in the vaccinia virus thymidine kinase gene. Viruses containing chimeric genomes can be identified by chromogenic screening or thymidine-kinase-negative selection.

Amino Acid Sequence↗

Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses.

In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera.

Base Composition↗

Resolution of poxvirus telomeres: processing of vaccinia virus concatemer junctions by conservative strand exchange.

The replication of vaccinia virus proceeds through concatemeric intermediates which are resolved into unit-length DNA. In vaccinia virus-infected cells, plasmids containing the vaccinia virus DNA junction fragment that connects concatemers are resolved into linear minichromosomes of vector DNA flanked by hairpin loops. Resolution requires two copies of a specific nucleotide sequence conserved among poxviruses and found proximal to the hairpin loop. This study demonstrates that orientation of each sequence with respect to the other as well as to the axis of symmetry is critical for resolution, the processing of plasmids containing heterologous pairs of resolution sites is influenced by mismatched nucleotides between the sites, and the vaccinia virus hairpin in the linear minichromosome is a heteroduplex composed of DNA from each strand of the concatemer junction. A model incorporating site-specific recombination and orientated branch migration is proposed to account for resolution of the vaccinia virus concatemer junction.

Base Sequence↗

Nucleotide sequence required for resolution of the concatemer junction of vaccinia virus DNA.

The mature form of the vaccinia virus genome consists of a linear, 185,000-base-pair (bp) DNA molecule with a 10,000-bp inverted terminal repetition and incompletely base-paired 104-nucleotide hairpin loops connecting the two strands at each end. In concatemeric forms of intracellular vaccinia virus DNA, the inverted terminal repetitions of adjacent genomes form an imperfect palindrome. The apex of this palindrome corresponds in sequence to the double-stranded form of the hairpin loop. Circular plasmids containing palindromic concatemer junction fragments of 250 bp or longer are converted into linear minichromosomes with hairpin ends when they are transfected into vaccinia virus-infected cells, providing a model system with which to study the resolution process. To distinguish between sequence-specific and structural requirements for resolution, plasmids with symmetrical insertions, deletions, and oligonucleotide-directed mutations within the concatemer junction were constructed. A sequence (ATTTAGTGTCTAGAAAAAAA) located on both sides of the apex segment was found to be critical for resolution. Resolution was more efficient when additional nucleotides, TGTG, followed the run of A residues. Both the location and sequence of the proposed resolution signal are highly conserved among poxviruses.

Base Sequence↗

Resolution of vaccinia virus DNA concatemer junctions requires late-gene expression.

Vaccinia virus replicates in the cytoplasm of infected cells, generating transient replicative intermediates containing the DNA for the terminal sequences as concatemeric junctions. The processing of the terminal sequences for a series of vaccinia virus conditional lethal mutants at the nonpermissive temperature was analyzed by restriction enzyme digestion and Southern blot hybridization of DNA isolated from infected cells. Three phenotypes were observed: DNA replication negative (Rep-), DNA replication positive but concatemer resolution negative (Rep+ Res-), and DNA replication positive and concatemer resolution positive (Rep+ Res+). Interestingly, all six Rep+ Res- mutants from separate complementation groups were defective in late protein synthesis. Isatin beta-thiosemicarbazone, a drug that blocks late protein synthesis, also prevented resolution of concatemers. Orthogonal field gel electrophoresis of the DNA generated by the late defective mutants revealed a distribution of linear genome multimers. The multimers were processed into mature monomers after a shift to the permissive temperature in the presence of cytosine arabinoside for all the Rep+ Res- mutants except ts22, an irreversible mutant which cleaves RNA late in infection (R.F. Pacha and R.C. Condit, J. Virol. 56:395-403, 1985). Genome formation can be divided into two stages: DNA replication, which generates concatemers, and resolution, which processes concatemers into monomers with hairpin termini. Early viral genes are required for the former, and late viral genes are required for the latter.

Animals↗

Intramolecular homologous recombination in cells infected with temperature-sensitive mutants of vaccinia virus.

I have used a plasmid containing two copies of the Saccharmyces cerevisiae his3 gene to study intramolecular homologous recombination in vaccina virus-infected cells. Recombination of the plasmid was monitored by restriction enzyme digestion and Southern blot hybridization in cells infected with representatives from each of 32 complementation groups of temperature-sensitive mutants ts42 and ts17 did not replicate nor detectably recombine the input plasmid. All except one of the mutants that synthesized normal amounts of viral DNA and protein replicated and recombined the plasmid in a manner indistinguishable from wild-type virus. The remaining mutant, ts13, only poorly replicated and recombined the input plasmid. Thus, the processes of replication and recombination could not be separated by using this battery of mutants. Viral mutants defective in late protein synthesis were unable to resolve the vaccinia virus concatemer junction in plasmids but carried out intramolecular homologous recombination with plasmids as efficiently as did wild-type virus at the conditionally lethal temperature. This result distinguishes homologous recombination, which requires early gene products, from resolution of concatemer junctions, which requires additional late gene products.

Cell Line↗

Molecular cloning and sequence of the concatemer junction from vaccinia virus replicative DNA. Viral nuclease cleavage sites in cruciform structures.

The concatemer junction from replicative forms of vaccinia virus DNA was cloned into plasmid vectors and shown to be a precise duplex copy of the viral terminal hairpin structure, with each strand corresponding to one of the alternative sequence isomers. The plasmids were relaxed circles with extruded cruciforms representing two copies of the vaccinia telomere hairpin structure. Head-to-head dimers containing two copies of the vaccinia virus concatemer junction were observed to contain only one set of stem-loop structures per molecule, suggesting that the initial formation of a small cruciform, and not branch migration, was the rate-limiting step in cruciform formation. The plasmids containing the concatemer junction were converted into nicked circular, linear and cross-linked linear molecules by a nuclease isolated from vaccinia virions. The region-specific cleavage near the border of the hairpin loop and the formation of DNA cross-links in some of the molecules is consistent with the nuclease acting as a nicking-closing enzyme that participates in the resolution of mature termini from replicative concatemer intermediates.

Base Sequence↗

Resolution of linear minichromosomes with hairpin ends from circular plasmids containing vaccinia virus concatemer junctions.

The junctions, separating unit-length genomes in intracellular concatemeric forms of vaccinia virus DNA, are duplex copies of the hairpin loops that form the ends of mature DNA molecules present in infectious virus particles. Circular E. coli plasmids with palindromic junction fragments were replicated in vaccinia virus-infected cells and resolved into linear minichromosomes with vector DNA in the center and vaccinia virus DNA hairpins at the two ends. Resolution did not occur when the concatemer joint was less than 250 bp or when plasmids were transfected into uninfected cells, indicating requirements for a specific DNA structure and viral trans-acting factors. These studies indicate that concatemers can serve as replicative intermediates and account for the generation of flip-flop sequence variation of the hairpins at the ends of the mature vaccinia virus genome.

Animals↗

The complete DNA sequence of minute virus of mice, an autonomous parvovirus.

We have determined the complete nucleotide sequence of the genome of Minute Virus of Mice, an autonomous parvovirus. This single-stranded DNA is 5081 nucleotides long. The 3'-and 5'-ends of the viral strand contain imperfect palindromic sequences which consist, respectively, of 115 and 206 nucleotides. The 3'-terminal palindrome is composed of a unique sequence, whereas the 5'-terminal palindrome contains two sequences in equimolar amounts; these are related in that one is the inverted complement of the other. The DNA strand complementary to that which is encapsidated into virions contains two large open reading frames which together span almost the entire genome. Transcriptional and translational signals within the sequence have been identified and related to the known map coordinates of the viral transcripts. In this report we summarize some of the salient structural and organizational features of the MVM genome.

Amino Acid Sequence↗

Developing new smallpox vaccines.

New stockpiles of smallpox vaccine are required as a contingency for protecting civilian and military personnel against deliberate dissemination of smallpox virus by terrorists or unfriendly governments. The smallpox vaccine in the current stockpile consists of a live animal poxvirus (Vaccinia virus [VACV]) that was grown on the skin of calves. Because of potential issues with controlling this earlier manufacturing process, which included scraping VACV lesions from calfskin, new vaccines are being developed and manufactured by using viral propagation on well-characterized cell substrates. We describe, from a regulatory perspective, the various strains of VACV, the adverse events associated with calf lymph-propagated smallpox vaccine, the issues regarding selection and use of cell substrates for vaccine production, and the issues involved in demonstrating evidence of safety and efficacy.

Animals↗