Biomedical subjects

M S Gilmore

Publications and source records attributed to M S Gilmore.

At least 55 records · Page 3Linked to original sources

PubMed1995

High-level gentamicin resistance among enterococci.

The bi-functional enzyme 6'-aminoglycoside acetyltransferase (AAC-6')-2" aminoglycoside phosphotransferase (APH-2"), which is encoded by the 2 kb fused gene aacA-aphD, mediates gentamicin resistance in Enterococcus faecalis. This gene is associated with the composite transposon Tn5281 that shares extensive homology with transposons Tn4001 and Tn4031 found in staphylococci. Typically these transposons are characterized by the resistance gene being flanked by 1.35 kb insertion sequences (IS256). The resistance gene (aacA-aphD) appears identical among all E. faecalis studied, but restriction enzyme analysis indicates notable heterogeneity within the flanking regions. Various combinations of IS256-like and IS257-like elements, or portions thereof, have been described in different resistant isolates. As gentamicin resistance has been described in other enterococcal species (E. faecium, E. avium, E. gallinarum, E. raffinosus, E. casseliflavus) homology with the resistance gene of E. faecalis has largely been maintained, but more extensive variations in the flanking sequences have been noted. Although many similarities exist among enterococcal gentamicin resistance determinants, heterogeneity in the flanking regions indicates that measurable divergence exists among these determinants. This divergence may be of value in characterizing the mechanisms and natural course of gentamicin resistance dissemination which now includes staphylococci, enterococci and streptococci.

Anti-Bacterial Agents↗

PubMed1994

A novel human airway mucin cDNA encodes a protein with unique tandem-repeat organization.

Highly specific affinity-purified polyclonal antibodies against deglycosylated human tracheobronchial mucin was used to select immunoreactive clones from a Uni-ZAP cDNA expression library prepared from normal human tracheal mRNA. The largest of three positive clones, designated pAM1, which reacted strongly with the polyclonal antibodies, was further characterized. Sequence analyses revealed a partial 941 bp cDNA that encoded a 313-amino-acid polypeptide. Bases 3-892 consisted of imperfect 41-nucleotide tandem repeats (CCAGGAGGGGACACCGGGTTCACGAGCTGCCCACGCCCTCT) that encoded a unique polypeptide with two types of consensus repeats, TSCPRPLQEGTRV and TSCPRPLQEGTPGSRAAHALSRRGHRVHELPTSSPGGDTGF. The overall composition of the deduced amino acid sequence matched that expected for a mucin protein core and is rich in serine, threonine, proline, glycine and alanine (approximately 51%). Northern blots probed with the mucin cDNA exhibited intense polydisperse hybridization bands with RNA isolated from normal human trachea and cystic-fibrosis bronchus. The data indicate that mucin encoded by clone pAM1 represents a unique type of peptide organization which has not been described in mucin cDNAs reported thus far.

Amino Acid Sequence↗

PubMed1994

Transferability and genetic relatedness of high-level gentamicin resistance among enterococci.

Gentamicin resistance in six enterococcal species was investigated. Transfer of resistance was observed for the donors E. faecium UC 79, E. avium CC 54, and E. gallinarum B 51, but not for E. raffinosus UC 78 or E. casseliflavus UC 73. Except for E. casseliflavus UC 73, homology was observed between the E. faecalis aac6'-aph2" gene and DNA from other species. Whereas 2.6-kb HindIII fragments encoded resistance in E. faecalis UC 244, its transconjugant, and E. raffinosus UC 78, 3.4-kb fragments encoded resistance in E. faecium UC 79, E. gallinarum B 51, and their transconjugants. A 3.4-kb fragment encoded resistance in E. avium CC 54, but 2.6-kb fragments encoded resistance in the transconjugants. Although many similarities were found among the strains, the heterogeneity in gentamicin resistance exhibited by some isolates indicates diversity among these determinants.

Blotting, Southern↗

PubMed1994

Virulence of enterococci.

Enterococci are commensal organisms well suited to survival in intestinal and vaginal tracts and the oral cavity. However, as for most bacteria described as causing human disease, enterococci also possess properties that can be ascribed roles in pathogenesis. The natural ability of enterococci to readily acquire, accumulate, and share extrachromosomal elements encoding virulence traits or antibiotic resistance genes lends advantages to their survival under unusual environmental stresses and in part explains their increasing importance as nosocomial pathogens. This review discusses the current understanding of enterococcal virulence relating to (i) adherence to host tissues, (ii) invasion and abscess formation, (iii) factors potentially relevant to modulation of host inflammatory responses, and (iv) potentially toxic secreted products. Aggregation substance, surface carbohydrates, or fibronectin-binding moieties may facilitate adherence to host tissues. Enterococcus faecalis appears to have the capacity to translocate across intact intestinal mucosa in models of antibiotic-induced superinfection. Extracellular toxins such as cytolysin can induce tissue damage as shown in an endophthalmitis model, increase mortality in combination with aggregation substance in an endocarditis model, and cause systemic toxicity in a murine peritonitis model. Finally, lipoteichoic acid, superoxide production, or pheromones and corresponding peptide inhibitors each may modulate local inflammatory reactions.

Animals↗

PubMed1994

Genetic structure of the Enterococcus faecalis plasmid pAD1-encoded cytolytic toxin system and its relationship to lantibiotic determinants.

Pheromone-responsive conjugative plasmids are unique to the species Enterococcus faecalis. Many pheromone-responsive plasmids, including those frequently isolated from sites of infection, express a novel cytolysin that possesses both hemolytic and bacteriocin activities. Further, this cytolysin has been shown to be a toxin in several disease models. In the present study, nucleotide sequence determination, mutagenesis, and complementation analysis were used to determine the organization of the E. faecalis plasmid pAD1 cytolysin determinant. Four open reading frames are required for expression of the cytolysin precursor (cylLL, cylLS, cylM, and cylB). The inferred products of two of these open reading frames, CyILL and CyILS, constitute the cytolysin precursor and bear structural resemblance to posttranslationally modified bacteriocins termed lantibiotics. Similarities between the organization of the E. faecalis cytolysin determinant and expression units for lantibiotics exist, indicating that the E. faecalis cytolysin represents a new branch of this class and is the first known to possess toxin activity.

Adenosine Triphosphate↗

PubMed1993

Nucleotide sequence of a cDNA for canine beta-spectrin reveals high evolutionary conservation.

A cDNA coding for the carboxy-terminus of canine beta-spectrin was isolated from a canine tracheal cDNA library. Analysis of the 3267 nucleotide sequence revealed a single open reading frame coding for 707 amino acids. Comparison of the deduced amino acid sequence to that of the recently reported general isoform of human beta-spectrin (beta G) revealed 98% identity. This high degree of conservation of the general isoform of beta-spectrin illustrates a strong evolutionary selection and should help in identification of sites that are candidates to mediate specialized functions of this general isoform. This is the first report of a cDNA encoding canine beta-spectrin.

Amino Acid Sequence↗

PubMed1992

Molecular cloning of the carboxy terminus of a canine tracheobronchial mucin.

A cDNA library constructed from canine tracheal mRNA was screened with polyclonal antiserum specific to canine tracheal apomucin (CTM-A). Eight antibody reactive clones were isolated and purified to clonality. One of the clones, designated pCTM-A, had a 1.7 kb insert and included a single open reading frame with a poly (A)+ tail. The amino acid composition of the encoded protein was consistent with that expected for CTM-A. The fusion protein produced by cloning the 1.7 kb insert in the pMALc expression vector reacted with the purified anti-apomucin CTM-A antibody. Also, polyclonal antibodies raised to the purified protein product encoded by pCTM-A reacted with deglycosylated CTM-A confirming that this clone does indeed code for apomucin CTM-A. This is the first report of a cDNA encoding the C-terminus of a canine tracheal mucin.

Amino Acid Sequence↗

PubMed1992

PCR amplification of streptococcal DNA using crude cell lysates.

Gram-positive organisms such as streptococci and enterococci are often difficult to lyse. Obtaining DNA for procedures such as PCR amplification usually requires a large scale isolation for each strain under investigation. We describe a simple procedure for small volumes of whole cells, involving pretreatment with detergent and proteinase that allows for efficient release of DNA for PCR amplification. This procedure is fast, reproducible, can be used with a large number of samples, and has been successfully applied to a variety of streptococcal and enterococcal strains.

Base Sequence↗

PubMed1992

Transfer of pheromone-inducible plasmids between Enterococcus faecalis in the Syrian hamster gastrointestinal tract.

Pheromone-responsive plasmids are common to Enterococcus faecalis, transfer at high frequency in vitro, and carry cytolysin and other gene products implicated in the pathogenesis of enterococcal infection. A Syrian hamster model of enterococcal intestinal overgrowth was used to test for transfer of three isogenic plasmids differing in conjugative and cytolytic phenotypes. Transconjugants were found in 8 (44%) of 18 and 6 (35%) of 17 hamsters given donor strains containing cytolytic (pAM714) and noncytolytic (pAM771) pheromone-responsive plasmids. Of the 14 hamsters from which transconjugants were isolated from stool, 9 (64%) had transconjugants 1 day after donor strain inoculation. The frequency of transfer (mean +/- SD) for pAM714 and pAM771 was 1.4 +/- 2.2 x 10(-1) and 2.9 +/- 4.2 x 10(-2) transconjugants/donor, respectively (P > .20). Transconjugants were not recovered from hamsters receiving a cytolytic, nonconjugative plasmid (pAM930; transfer frequency < 2 x 10(-5) transconjugants/donor). Pheromone-responsive plasmid transfer between E. faecalis strains occurs at high frequency in the gastrointestinal tract of hamsters and may be one means by which enterococcal resistance and virulence factors disseminate.

Amino Acid Sequence↗

PubMed1992

Effects of amino acids on expression of enterococcal vancomycin resistance.

The effects of various amino acids on vancomycin MICs obtained with resistant enterococci was investigated by using broth dilution testing. For both the type A (i.e., possessing transferable resistance to teicoplanin and vancomycin) and the type B (i.e., possessing teicoplanin susceptibility and nontransferable vancomycin resistance) resistant strains, vancomycin MICs in the presence of glycine were substantially lower than those in unsupplemented broth (range of MIC decrease, 8- to 128-fold). No such effect was seen with Enterococcus gallinarum AIB-39 or with the susceptible control Enterococcus faecalis ATCC 29212. Further testing of two type B strains (E. faecalis V583 and V583-2) showed that certain other amino acids (i.e., D-methionine, D-serine, D-alanine, and D-phenylalanine) had effects similar to that of glycine. Results of sodium dodecyl sulfate-polyacrylamide gel electrophoresis with membrane preparations from these strains revealed the production of vancomycin-inducible proteins of sizes comparable to those describe for other enterococcal isolates that exhibit acquired vancomycin resistance. Even in the presence of 0.2 M glycine, the inducible proteins were produced. These results indicate that certain amino acids specifically interfere with the mechanism(s) of acquired vancomycin resistance in enterococci and that the nature of interference probably involves inhibition or circumvention of the inducible proteins' functions.

Amino Acids↗

PubMed1992

Contribution of the pAD1-encoded cytolysin to the severity of experimental Enterococcus faecalis endophthalmitis.

The contribution of the pAD1-encoded cytolysin to Enterococcus faecalis virulence in an experimental endophthalmitis model was studied by using isogenic strains differing only in the location of transposon Tn917. The course of experimental endophthalmitis in New Zealand White rabbits was evaluated by postoperative reduction in retinal neuroresponsiveness, thin-section histopathology, and transmission electron microscopy. Infections caused by cytolytic E. faecalis resulted in 99% loss of retinal function at postoperative day 3, while isogenic, noncytolytic strains produced reductions of only 74.2%. Light microscopy revealed near-total destruction of retinal architecture at 24 h postinfection with cytolytic E. faecalis, while noncytolytic strains produced few or no destructive changes. Transmission electron microscopy revealed tissue destruction in retinal layers as early as 6 h postinfection with cytolytic E. faecalis. In vivo and in vitro growth rates of cytolytic and noncytolytic E. faecalis showed similar kinetics. These data demonstrate the contribution of the pAD1-encoded cytolysin to both the course and the severity of experimental E. faecalis endophthalmitis.

Animals↗

PubMed1992

A hemolysin-encoding plasmid contributes to bacterial virulence in experimental Enterococcus faecalis endophthalmitis.

Beta-hemolysin production is a variable trait of the Lancefield group D streptococcus, Enterococcus faecalis. The E. faecalis hemolysin is encoded by large transmissible plasmids. The variable nature of this putative virulence factor provided an ideal system for testing its contribution in experimental endophthalmitis. In this study, isogenic E. faecalis strains were compared to determine whether the presence of the hemolysin-encoding plasmid affected the severity of disease in a rabbit endophthalmitis model. Experimental infections (n = 6) with 10(1)-10(4) E. faecalis organisms harboring the hemolysin-encoding plasmid resulted in a 98% loss of retinal function (by electroretinography [ERG]) and white reflex by postoperative day 3. By contrast, infections of similar numbers of plasmid-free E. faecalis organisms (n = 5) resulted in retention of some retinal function (23% per ERG) with a red reflex demonstrated on postoperative day 3. Results of light microscopy, slit-lamp examination, ERG, and indirect ophthalmoscopy indicated that infections with hemolysin-encoding plasmid-containing E. faecalis resulted in a more aggressive endophthalmitis compared with the endophthalmitis caused by plasmid-free E. faecalis. This is the first endophthalmitis model to the authors' knowledge that specifically evaluates bacterial virulence using isogenic strains.

Animals↗

PubMed1991

Bacteremia caused by hemolytic, high-level gentamicin-resistant Enterococcus faecalis.

Between 1 January 1984 and 31 December 1987, 206 enterococcal blood isolates at the University of Wisconsin Hospital and Clinics were analyzed for high-level aminoglycoside resistance (hereafter high-level aminoglycoside resistance is simply referred to as "resistance") and hemolysin production. Of 190 Enterococcus faecalis isolates, 68 (35.8%) were resistant to gentamicin. Of these 68 strains, 67 (98.5%) contained a gene coding for the bifunctional aminoglycoside-modifying 6'-aminoglycoside acetyltransferase-2"-aminoglycoside phosphotransferase [AAC(6')-APH(2")] enzyme. Of 190 isolates, 85 (44.7%) were hemolytic and contained a gene coding for component A of the enterococcal hemolysin. Sixty-two of 68 (91.2%) gentamicin-resistant isolates but only 23 of 122 (18.8%) gentamicin-susceptible isolates were hemolytic (P less than 0.001). Twelve of the hemolytic, gentamicin-resistant E. faecalis blood isolates, but only 2 of 9 nonhemolytic or gentamicin-susceptible isolates, had identical chromosomal DNA restriction endonuclease digestion patterns, suggesting a common derivation for these strains. A historical cohort study from 1 July 1985 to 31 March 1987 identified by regression analysis postsurgical intensive care unit status (odds ratio [OR], 5.0; 95% confidence interval [CI], 1.1 to 22.8) and prior treatment with an expanded- or broad-spectrum cephalosporin (OR, 3.0; 95% CI, 0.9 to 10.1) as risk factors for gentamicin-resistant E. faecalis bacteremia. Patients with hemolytic, gentamicin-resistant E. faecalis bacteremia had a fivefold-increased risk for death within 3 weeks of their bacteremia compared with patients with nonhemolytic, gentamicin-susceptible strains (95% CI, 1.0 to 25.4).

Bacteremia↗

PubMed1991

Molecular characterization of the Enterococcus faecalis cytolysin activator.

The gene encoding component A (cylA), the activator protein of the Enterococcus faecalis cytolysin, has been localized on pAD1, and the nucleotide sequence was determined. cylA consists of a 1,236-bp open reading frame encoding a 412-amino-acid polypeptide. A search of the National Biomedical Research Foundation data base revealed significant homology between the inferred amino acid sequence of component A and subtilisin BPN'. Component A activation of the cytolysin precursor (component L) was observed to be inhibited by the serine protease inhibitor diisopropylfluorophosphate. Mature component A exhibits a molecular weight of approximately 30,000 and an isoelectric point of 4.5. Differences between the size of the primary translation product (45,625 daltons) and the mature enzyme suggest that, as for subtilisin, component A is secreted as a proenzyme. These results provide the basis for a model of component A activation of component L and a role for component A in protecting the cytolysin-producing cell from lysis.

Amino Acid Sequence↗

PubMed1991

Translation of messenger RNA from canine tracheal epithelial cells: identification of mucin core protein.

A high-molecular-weight mucin (Mr approximately 11.0 x 10(6)) was purified from canine tracheal pouch secretions. The mucin was deglycosylated by treatment with trifluoromethane sulfonic acid for 8 h at 8 degrees C and subsequently with alpha-N-acetylgalactosaminidase. These treatments almost completely removed the carbohydrate moieties. The amino acid compositions of the deglycosylated and native mucins were similar, indicating that the deglycosylation procedure used did not cause notable degradation of the protein core. Antiserum specific for deglycosylated canine tracheal mucin was produced by immunization of rabbit with the antigen. RNA was isolated from fresh canine tracheal epithelial cells by extraction with guanidine isothiocyanate/hydrochloride and further fractionated by chromatography on oligo(dT)-cellulose to yield poly(A)+ RNA. The poly(A)+ RNA was translated in a rabbit reticulocyte cell-free translation system using [35S]methionine and [3H]leucine as radiolabels. The translation products were analyzed by gel electrophoresis and fluorography before and after immunoprecipitation with the antiserum to deglycosylated mucin. A labeled product of molecular weight 72,000 was present in the immunoprecipitate. When canine liver poly(A)+ RNA was used as control, no radioactivity above background was detected in the immunoprecipitate. It is concluded that the primary translation product of the canine tracheal epithelial cells is a 72,000-D protein and the monomer subunit of the mucin is about 167,000 D. Thus, in the native state, the canine tracheal mucin consists of several associating subunits.

Amino Acids↗

PubMed1991

Enterococcus: an old pathogen with new tricks.

Recent clinical enterococcal isolates from the Oklahoma City Department of Veterans Affairs Medical Center were screened for high-level aminoglycoside resistance, vancomycin resistance, beta-lactamase production, and hemolysin production. Twenty-nine of 53 (55%) enterococcal isolates had high-level resistance to gentamicin, kanamycin, or streptomycin; 27 of these isolates were from the blood and 16 (59%) showed high-level gentamicin resistance. Twenty-one percent of 259 enterococcal isolates from blood, urine, stool, and other sources were hemolytic. Of thirteen blood isolates tested for both high-level gentamicin resistance and hemolysin production, 6 (46%) showed both characteristics. Vancomycin-resistant or beta-lactamase-producing isolates were not found. Nineteen of 21 charts from patients with premortem enterococcal blood isolates were reviewed, and no correlation was found between appropriate antibiotic treatment for high-level gentamicin-resistant or susceptible enterococcal bacteremia and outcome. Enterococci with multiple high-level aminoglycoside resistance, but not vancomycin resistance or beta-lactamase production, are common at this referral medical center. Clinical microbiology laboratories in Oklahoma should routinely screen enterococcal isolates causing potentially serious infections (eg, from blood or cerebral spinal fluid) for high-level aminoglycoside resistance.

Anti-Bacterial Agents↗

PubMed1990

High efficiency introduction of plasmid DNA into glycine treated Enterococcus faecalis by electroporation.

A highly efficient electroporation system for Enterococcus faecalis was developed by systematically optimizing different parameters. One parameter found to be particularly critical for electroporation was cultivation of E. faecalis in medium containing a high glycine concentration, prior to electroporation. Osmotic stabilization of cells with 0.5 M sucrose was also found to be critical during glycine treatment. 10(6) transformants per microgram of plasmid DNA were consistently obtained within 48 h. Electrocompetent preparations of E.-faecalis could be stored at - 70 degrees C without loss of competence.

DNA, Bacterial↗

PubMed1990

An HlyB-type function is required for expression of the Enterococcus faecalis hemolysin/bacteriocin.

The nucleotide sequence of a 3,422-bp internal restriction fragment from the Enterococcus faecalis pAD1 hemolysin/bacteriocin-encoding region was determined. This fragment was associated with expression of hemolysin/bacteriocin component L and contained a 2,142-bp open reading frame. The inferred amino acid sequence revealed a protein which shared extensive similarity with HlyB of the Escherichia coli alpha-hemolysin operon. The inferred protein, CylB, was observed to be independently expressed in E. coli and capable of complementing an insertion mutation in the cloned hemolysin/bacteriocin operon in trans. Despite the extensive similarity to HlyB, CylB was incapable of complementing an insertion mutation in hlyB. Cytolysin determinants possessing an HlyB-type transport function are widely dispersed throughout gram-negative genera. We believe this to be the first example of an HlyB-type protein encoded within a cytolysin determinant from a gram-positive bacterium.

Adenosine Triphosphate↗