PubMed Health⌕ Search

Biomedical subjects

M Wittner

Publications and source records attributed to M Wittner.

At least 91 records · Page 5Linked to original sources

Pyrimethamine concentrations in serum during treatment of acute murine experimental toxoplasmosis.

Central nervous system toxoplasmosis is a major opportunistic infection in patients with acquired immunodeficiency syndrome. The standard therapy for this infection is pyrimethamine (PYR) and sulfonamides. To assess in vivo if PYR alone could adequately treat toxoplasmosis, a murine model of acute toxoplasmosis was used. The CD1 strain of mice was infected intraperitoneally with 10(4) parasites of the RH strain of Toxoplasma gondii. Pyrimethamine was administered in mouse chow at concentrations of 0, 0.03125, 0.0625, 0.125, 0.25, or 1.0 mg of PYR/g of food, which provides the following daily PYR dosages: 0, 6.25, 12.5, 25, 50, and 200 mg/kg/day. No sulfonamides were administered. Serum PYR levels proved more accurate than mg of PYR/g of food in predicting survival. Mice with serum PYR levels greater than or equal to 500 ng/ml (2 microM) survived and had no parasites present on peritoneal lavage. Mice with serum PYR levels less than 100 ng/ml (0.4 microM) had a 100% mortality rate and the average parasite count was 3 x 10(7) organisms in the lavage fluid. At a PYR level of 370 ng/ml, six of 11 mice survived and the lavage fluid contained 2.5 x 10(5) organisms. Previously, using 3H-uracil in an in vitro assay, PYR at a concentration of 500 ng/ml was shown to be as effective in inhibiting Toxoplasma growth as the combination of PYR (100 ng/ml) and sulfonamides 25 micrograms/ml). These data suggest the potential usefulness of PYR for monotherapy of toxoplasmosis and are consistent with previously described in vitro assays.

Acute Disease↗

Diagnosis of Encephalitozoon cuniculi infection by western blot and the use of cross-reactive antigens for the possible detection of microsporidiosis in humans.

Microsporidia are very primitive, eukaryotic, obligate, intracellular, protozoan parasites. Encephalitozoon cuniculi, a microsporidian originally described from a rabbit infection, has been described in humans as well as in many species of laboratory animals. We report the detection of E. cuniculi by Western blotting in a rabbit with torticollis that was obtained from an Encephalitozoon-free colony. Cross-reactivity of this serum was observed with antigens prepared from several genera of microsporidia. Identical Western blotting patterns were obtained with sera obtained from a rabbit immunized with E. cuniculi that was purified from tissue culture cells. In addition, we were able to demonstrate cross-reactivity between E. cuniculi rabbit antisera and Enterocytozoon bieneusi antigens by indirect immunofluorescent assay techniques in human intestinal biopsy samples. These cross-reactions between microsporidia may be useful in developing diagnostic tests for non-cultivatable microsporidia such as Enterocytozoon bieneusi.

Animals↗

Detection of HIV-1 protein and nucleic acid in enterochromaffin cells of HIV-1-seropositive patients.

Diarrhea contributes significantly to the morbidity and mortality of patients with the acquired immunodeficiency syndrome (AIDS). Up to 50% of AIDS patients have diarrhea, and an etiologic agent for this cannot be identified in all of them. Recent evidence suggests that enterochromaffin cells may be infected by the human immunodeficiency virus type 1 (HIV-1) and may contribute to the unexplained diarrhea. To test this hypothesis further, endoscopic biopsies of duodena from 22 HIV-1 seropositive patients [17 with diarrhea (> 500 g/day and > 3 bowel movements/day), five without diarrhea] and from 15 normal controls (no HIV risk factors) without diarrhea were studied. Formalin-fixed and paraffin-embedded 5-microns sections were examined by immunocytochemistry, using a monoclonal antibody to the HIV-1 gp41 protein, and by in situ hybridization with a full-length biotinylated HIV-1 DNA probe. Positive staining for gp41 was detected in crypt cells, consistent with the location, size, and morphology of enterochromaffin cells, in 11 of 17 HIV-1-seropositive patients with diarrhea, and in none of five without diarrhea. Nucleic acid hybridization staining was performed in five of the 11 patients who had positive gp41 staining; all showed HIV nucleic acid sequences in similar cells. All three of the five patients with positive staining for HIV nucleic acid sequences had diarrhea for which no etiologic agent for diarrhea could be found, and one each had cryptosporidia or microsporidia. No staining was observed in any of the samples from normal control tissues. These results suggest that HIV-1 may infect enterochromaffin cells and possibly alter their function. This, in turn, may contribute to the diarrhea associated with AIDS.

Adult↗

Blastocystis hominis in hospital employees.

Several reports have appeared that either support or deny the importance of the protozoan Blastocystis hominis as an intestinal pathogen in humans. In this report, we describe the clinical characteristics of B. hominis and its response to therapy in hospital employees found to have the parasite on routine screening of stools. During the study, 49 patients with B. hominis were identified, and 413 stools were examined from these patients. Twenty-nine patients were asymptomatic (59%), and 20 had symptoms of bloating, flatulence, soft/loose stools, or constipation. Of these 20 patients, 10 had symptoms that correlated with the presence or absence of B. hominis, four had symptoms that were independent of B. homonis, and six had other intestinal parasites that could account for their symptoms. Nineteen percent of patients without treatment had eradication of B. hominis from stool on follow-up examination. Metronidazole did not increase this rate. Iodoquinol treatment eradicated the organism in 41% of patients (p less than 0.05), and resulted in the reduction or eradication of the parasite in 62%, as determined by follow-up examination.

Adolescent↗

Medical management of AIDS patients. Gastrointestinal manifestations.

Gastrointestinal manifestations of AIDS are common. Opportunistic infections and tumors may affect any portion of the GI tract from oral cavity to anus. Esophageal involvement may result from Candida, CMV, HSV, HIV, and tumors. Biliary tract and pancreatic disease may cause abdominal pain. Diarrhea occurs in over 50% of AIDS patients and is multifactorial.

Abdominal Pain↗

Effect of octreotide on refractory AIDS-associated diarrhea. A prospective, multicenter clinical trial.

OBJECTIVE: To determine the efficacy and safety of octreotide for treatment of refractory, profuse diarrhea in patients with the acquired immunodeficiency syndrome (AIDS). DESIGN: A prospective, open-label study. SETTING: Inpatient metabolic units of four university medical centers. PATIENTS: Fifty-one patients infected with human immunodeficiency virus (HIV) who had uncontrolled diarrhea (greater than or equal to 500-mL liquid stool per day) despite treatment with maximally tolerable doses of antidiarrheal medications. INTERVENTION: After initial baseline studies, patients received octreotide, 50 micrograms every 8 hours for 48 hours. If stool volume was not reduced to less than 250 mL/d, the dose of octreotide was increased stepwise to 100, 250, and 500 micrograms. MAIN RESULTS: Fifty men and one woman (mean age, 36.3 +/- 1.1 years) entered and completed the 28-day protocol (14 days of inpatient therapy and 14 days of outpatient therapy). Stool frequency and volume decreased significantly (6.5 +/- 0.5 stools per day on day 0 compared with 3.8 +/- 0.3 stools per day on day 21 [P less than 0.001] and 1604 +/- 180 mL/d on day 0 compared with 1084 +/- 162 mL/d on day 14 [P less than 0.001], respectively). Twenty-one patients (41.2%) were considered to be partial or complete responders (reduction in daily stool volume by greater than or equal to 50% of initial collections or reduction to less than or equal to 250 mL/d). Of the 21 responders, 14 (67%) had no identifiable pathogens at initial screening compared with 9 of 30 (30%) nonresponders (P less than 0.01). CONCLUSION: Patients with AIDS-associated refractory watery diarrhea, especially those without identifiable pathogens, may respond favorably to subcutaneously administered octreotide. This drug deserves further study in a randomized, placebo-controlled trial.

Acquired Immunodeficiency Syndrome↗

Vasopressin stimulation of NaCl transport in the medullary thick ascending limb of Henle's loop is decreased in aging mice.

The maximal urinary osmolality that can be reached by the kidney is reduced with age. This may be due to impaired NaCl transport by the medullary thick ascending limb of Henle's loop, which is part of the renal concentrating mechanism and is modulated by antidiuretic hormone (ADH). We therefore tested in vitro a possible age-related change in the transport capacity and in the response of this nephron segment to ADH in young (1-2 months) and old (20-24 months) mice. The transepithelial potential difference (Vte) was significantly higher in young mice (+8.5 +/- 0.4 mV, n = 13) than in old ones (+6.6 +/- 0.5 mV, n = 17). Addition of 0.1 nmol.1-1 ADH to the bath solution significantly increased Vte by 5.2 +/- 0.5 mV in the young and by 3.1 +/- 0.6 mV in the old animals. Application of dibutyryl-cAMP (0.1 mmol.1-1) did not further increase the hormonal response in both groups. The ADH-mediated increase in the corresponding equivalent short-circuit current (ISC = Vte/Rte) was twice as great in young mice as in old, indicating that the stimulation of NaCl transport by ADH across the medullary thick ascending limb is significantly reduced with age. These results suggest that the previously reported age-related defect in the urinary concentrating ability of the kidney is partly due to a decreased response of the medullary thick ascending limb to ADH.

Aging↗

Stimulation of NaCl reabsorption by antidiuretic hormone in the cortical thick ascending limb of Henle's loop of the mouse.

The effect of antidiuretic hormone (ADH) on transepithelial Na+ Cl-, Ca2+ and Mg2+ net fluxes (JNa, JCl, JMg, JCa) was investigated in isolated perfused cortical thick ascending limb segments (cTAL) of the mouse nephron, using the microperfusion technique and the electron microprobe analysis to determine the ionic composition of the collected tubular fluid. Simultaneously, the transepithelial potential difference (PDte) and the transepithelial resistance (Rte) were recorded. Prior to the flux measurements cTAL segments were perfused for one hour. During this equilibration period PDte decreased significantly from +19.9 +/- 1.6 to +14.9 +/- 1.1 mV and Rte increased from 30.6 +/- 3.5 omega cm2 to 38.8 +/- 2.4 omega cm2 (n = 7), reflecting a decline in NaCl transport. After ADH was added to the bath solution at 10(-10) mol.l-1, PDte increased from +14.4 +/- 1.1 to +18.0 +/- 1.5 mV, accompanied by a rise in JNa and JCl from 205 +/- 11 to 273 +/- 19 and from 216 +/- 12 to 283 +/- 21 pmol.min-1.mm-1 (n = 7), respectively. JCa and JMg also increased from 0.81 +/- 0.07 to 1.50 +/- 0.12 and from 0.43 +/- 0.11 to 0.76 +/- 0.08 pmol.min-1.mm-1 (n = 7), respectively. All these effects were fully reversible after withdrawal of the hormone. In conclusion our data indicate that ADH stimulates divalent cation transport and NaCl transport in the cortical thick ascending limb of Henle's loop of the mouse.

Animals↗

Light microscopic diagnosis of human microsporidiosis and variable response to octreotide.

Microsporida are protozoan parasites that have recently been identified as a cause of human disease in immunocompromised patients. Because of their small size, they have been recognized primarily by electron microscopy. This has limited the study of their prevalence, incidence, and association with large-volume diarrhea. The present report describes two cases of Enterocytozoon bieneusi infection of the small intestine in patients with intractable diarrhea in whom the diagnosis was made by light microscopy and confirmed by electron microscopy. Both patients were treated with octreotide, and one had a good response.

Acquired Immunodeficiency Syndrome↗

Modulation of host cell metabolism by Trypanosoma cruzi.

Chagas disease, caused by the hemoflagellate Trypanosoma cruzi, is a complicated and devastating disease. It is hypothesized that an important target of infection may be the endothelial cell and that both the acute and chronic forms of the disease involve abnormalities in the microcirculation. Stephen Morris and colleagues suggest that endothelial cell dysfunction occurs as a consequence of amastigote-associated interference in host cell metabolism.

Journal Article↗

Sensitive and specific detection of toxoplasma DNA in an experimental murine model: use of Toxoplasma gondii-specific cDNA and the polymerase chain reaction.

Toxoplasma gondii, an apicomplexan parasite of mammals and birds, is well recognized as a cause of encephalitis in AIDS patients and as a cause of congenital infections. The polymerase chain reaction (PCR) and toxoplasma cDNA clones were used to diagnose T. gondii infection in an acute murine model of toxoplasmosis. Diagnosis of tissue infection by Southern blot hybridization with cDNA clones of T. gondii was possible within 5 days of infection. This technique could detect as few as 10,000 organisms. Specific T. gondii gene amplification by PCR using the primers 5'CACACGGTTGTATGTCGGTTTCGCT3' and 5'TCAAGGAGCTCAATGTTACAGCCT3' followed by oligonucleotide hybridization using 5'GCGGTCATTCTCACACCGACGGAGAACCACTTCACTCTCA3' allowed detection of T. gondii in the tissue of mice by day 2 after infection and in the blood of mice by day 5 after infection with RH strain T. gondii. This technique could detect as few as 10 organisms. Thus, these techniques may be useful in the diagnosis of toxoplasmosis.

Animals↗

Successful management of intractable cryptosporidial diarrhea with intravenous octreotide, a somatostatin analogue.

A 38-year-old man with AIDS and intractable large-volume diarrhea due to a cryptosporidial infection was successfully treated with intravenous octreotide, a somatostatin analogue. The volume of diarrhea, 10-12 liters with 8-13 movements per day, was reduced to three to four semi-formed to formed stools per day when the patient was treated with 400 micrograms intravenous octreotide daily. The patient's intravenous hyperalimentation was discontinued and he returned to oral feeding. He quickly regained his normal weight and has now resumed his normal activities. For those patients who cannot tolerate subcutaneous administration, intravenous octreotide therapy may not only be life-saving but may also markedly increase the quality of life. Roxithromycin, a macrolide antibiotic, was also administered to this patient with cryptosporidiosis but efficacy was not demonstrated.

Acquired Immunodeficiency Syndrome↗

Incidence of intestinal parasitic disease in an acquired immunodeficiency syndrome day-care center.

In June, 1986, the Bronx Municipal Hospital Center opened an acquired immunodeficiency syndrome day-care center to provide a quality educational experience for children infected with the human immunodeficiency virus. A major concern was the possibility of increasing secondary infections among these immunocompromised children by placing them in a group environment. One particular worry was intestinal parasitic disease, a serious public health problem in day-care centers throughout the United States. To minimize the risk of parasitic infections, scrupulous hygienic and monitoring procedures were instituted at the acquired immunodeficiency syndrome day-care center. This study reports the incidence of intestinal parasitic disease at the acquired immunodeficiency syndrome day-care center during its first 40 months of operation, encompassing 669 child-months of enrollment, with 131 stool specimens examined for ova and parasites. There were 2 cases of parasitic infection: Entamoeba histolytica in an asymptomatic 6-year-old and Giardia intestinalis in a 7-year-old with diarrhea. In neither case was there any secondary spread. None of the 15 children in diapers had a positive specimen, and we found no Cryptosporidium. Our experience suggests that with appropriate precautions human immunodeficiency virus-infected children can participate in a group day-care program without excessive risk for parasitic disease. Strict adherence to hygienic procedures may also decrease the risk of intestinal parasitic disease among healthy children attending day-care centers.

Acquired Immunodeficiency Syndrome↗

Consequences of differential effects of ADH and other peptide hormones on thick ascending limb of mammalian kidney.

Several hormones stimulate the adenylate cyclase system of the thick ascending limb (TAL). There are, however, some species differences concerning the cyclase sensitivity and the hormonal response in this nephron segment. In the mouse, antidiuretic hormone (ADH), parathyroid hormone, glucagon, calcitonin, and isoproterenol stimulate Na+, Cl-, Mg2+, and Ca2+ transports in the cortical TAL, whereas ADH, glucagon, and isoproterenol stimulate NaCl transport only in the medullary TAL. Many of these effects are different from those previously described for the corresponding segments of the rabbit nephron. The close similarity of the cyclase responsiveness to hormones of the mouse and rat TALs makes it possible to interpret the micropuncture data obtained in vivo in the rat superficial (S) and juxtamedullary (JM) nephrons, in the light of the in vitro data obtained in the mouse. Long-term treatment of Brattleboro rats with ADH also elicits differential effects along the TAL. Their consequences on the function of the S and JM nephrons are also examined. There are several indications supporting the view that the newly described hormonal effects in the mouse and rat are of physiological relevance.

Animals↗

Myocardial beta-adrenergic adenylate cyclase complex in a canine model of chagasic cardiomyopathy.

Infection of beagles with an opossum-derived strain of Trypanosoma cruzi (Tc-O) results in features of early and chronic chagasic cardiomyopathy, that is, increases in PR interval, atrioventricular block, and frequent ventricular premature contractions, ventricular tachycardia, and decreased left ventricular ejection fraction. These signs are not observed in animals infected with a canine strain of T. cruzi (Tc-D). To understand the biochemical basis for these early cardiac effects, we examined the beta-adrenergic adenylate cyclase complex in myocardial membranes prepared from animals infected with either of the two strains. In animals infected with Tc-O (symptomatic), the maximum velocity (Vmax) decreased and concentration of agonist resulting in 50% of Vmax (Kact) increased for isoproterenol-dependent adenylate cyclase activity; in animals infected with Tc-D (asymptomatic), Vmax and Kact for isoproterenol were unchanged from control, uninfected animals. beta-Receptor density decreased by 20% in symptomatic animals with no change in affinity, whereas no differences were observed between uninfected and infected asymptomatic animals. A complex pattern of changes was apparent in the guanine nucleotide binding protein, Gs, in the setting of infection. Alterations in cholera toxin-dependent ADP-ribosylation patterns as well as immunochemical detection with anti-G alpha s antisera suggested a change in the biochemical nature of the Gs species and not necessarily a physical loss of this protein. Reconstitution of adenylate cyclase activity in cyc- membranes demonstrated a decrease in hormone-sensitive Gs activity in membranes prepared from symptomatic animals without a change in activity demonstrable in the presence of Gpp(NH)p. Collectively, the results suggest that the depression in beta-adrenergic adenylate cyclase activity associated with symptomatic infection of beagles with T. cruzi occurs primarily as a result of changes in the Gs protein complex, most likely resulting in an uncoupling of the beta-adrenergic receptor from the Gs protein.

Adenosine Diphosphate Ribose↗

How do loop diuretics act?

In the thick ascending limb of the loop of Henle, NaCl reabsorption is mediated by a Na+/2Cl-/K+ cotransport system, present in the luminal membrane of this nephron segment. Loop diuretics such as furosemide (frusemide), piretanide, bumetanide and torasemide bind reversibly to this carrier protein, thus reducing or abolishing NaCl reabsorption. This leads to a decrease in interstitial hypertonicity and thus to a reduced water reabsorption. In nephron segments other than the thick ascending limb, loop diuretics have no quantitative importance with respect to their saluretic and diuretic activities. Loop diuretics also reduce Ca++ and Mg++ reabsorption in the thick ascending limb in a way which is still not clear. Furthermore, these drugs increase the urinary K+ excretion by enhancing distal tubular K+ secretion and reducing K+ reabsorption in the loop of Henle. Finally, by reduction of active NaCl transport, loop diuretics drastically reduce the substrate requirement and oxygen dependence of the thick ascending limb cells. This renders these cells, which are characterised by high transport rates and only limited substrate reserves, less vulnerable in acute renal failure.

Animals↗

[Role of vasopressin in the modifications of renal function during aging].

In the course of aging, the renal concentrating ability is markedly reduced. This defect may result from an inappropriate synthesis of antidiuretic hormone in the central nervous system or may be due to an impaired renal response to vasopressin. The two hypotheses have been studied in vivo in rats and in vitro in mice. The results of these studies indicated that: 1) dehydration induces a comparable release of vasopressin along the hypothalamo-hypophysial axis in 10, 20 and 30 month-old rats; 2) there is no change with age of the number of nephrons, single nephron filtration rate or transport capacity of Henle's loop of cortical nephrons which could account for an impaired renal response to vasopressin; 3) the reduced concentrating ability of the kidney appears to be linked to a decreased response of the medullary thick ascending limb of Henle's loop which in part is responsible for the cortico-papillary gradient of solutes within the kidney.

Age Factors↗

Resolution of Cryptosporidium infection in an AIDS patient after improvement of nutritional and immune status with octreotide.

An AIDS patient with severe large volume diarrhea and malnutrition due to cryptosporidial infection is presented. The patient, who was not receiving zidovudine, was treated with octreotide with resolution of diarrhea leading to improvement in nutritional status, immune functions, and subsequently, resolution of the Cryptosporidium infection. This case points out the need for adequate nutrition in AIDS patients and highlights the relationship of nutrition and the immune system.

Acquired Immunodeficiency Syndrome↗