PubMed Health⌕ Search

Biomedical subjects

Manuel Espinosa-Urgel

Publications and source records attributed to Manuel Espinosa-Urgel.

10 recordsLinked to original sources
PubMed2006

A two-partner secretion system is involved in seed and root colonization and iron uptake by Pseudomonas putida KT2440.

We describe the first two-partner secretion system known to play a role in mutualistic plant-bacterial interactions, identified in the soil and rhizosphere-colonizing bacterium Pseudomonas putida KT2440. The genes coding for the two components of the system are organized in an operon, which we have named hlpBA. HlpA is a secreted protein that has similarities with iron-regulated haemolysins, while HlpB would be responsible for the activation and transport of HlpA across the outer membrane. Mutations in this novel two-partner secretion system result in reduced capacity to colonize corn seeds. When introduced in the rhizosphere, hlpA and hlpB mutants show no competitive disadvantage, but the number of cells attached to the root surface is reduced with respect to the wild type, suggesting this protein plays a role directly in the bacterial cell-root surface interaction. Under iron-limiting conditions, the presence of a truncated HlpA causes reduced viability and high levels of siderophore release. These data further strengthen our previous observations indicating the importance of iron acquisition for attachment of P. putida KT2440 to plant surfaces.

Bacterial Adhesion↗
PubMed2006

Characterization of the Pseudomonas putida mobile genetic element ISPpu10: an occupant of repetitive extragenic palindromic sequences.

We have characterized the Pseudomonas putida KT2440 insertion element ISPpu10. This insertion sequence encodes a transposase which exhibits homology to the transposases and specific recombinases of the Piv/Moov family, and no inverted repeats are present at the borders of its left and right ends, thus constituting a new member of the atypical IS110/IS492 family. ISPpu10 was found in at least seven identical loci in the KT2440 genome, and variants were identified having an extra insertion at distinct loci. ISPpu10 always appeared within the core of specific repetitive extragenic palindromic (REP) sequences TCGCGGGTAAACCCGCTCCTAC, exhibiting high target stringency. One intragenic target was found associated with the truncation of a GGDEF/EAL domain protein. After active in vitro transposition to a plasmid-borne target, a duplication of the CT (underlined above) at the junction as a consequence of the ISPpu10 insertion was experimentally demonstrated for the first time in the IS110/IS492 family. The same duplication was observed after transposition of ISPpu10 from a plasmid to the chromosome of P. putida DOT-T1E, an ISPpu10-free strain with REPs similar to those of strain KT2440. Plasmid ISPpu10-mediated rearrangements were observed in vivo under laboratory conditions and in the plant rhizosphere.

Amino Acid Sequence↗
PubMed2005

Role of iron and the TonB system in colonization of corn seeds and roots by Pseudomonas putida KT2440.

Iron, which is abundant in corn (Zea mays L.) seeds, plays an important role in the initial establishment of Pseudomonas putida KT2440 populations on seeds. Sequestration of seed-borne iron by chelators decreases the capacity of KT2440 to initiate attachment to corn seeds. The importance of iron for this plant-bacteria interaction is further supported by the fact that mutations in the TonB system, which is key for iron uptake, result in reduced seed colonization. TonB is also a primary determinant of the fitness of P. putida in the rhizosphere, as a deletion mutant shows a clear competitive disadvantage during colonization of corn roots.

Bacterial Adhesion↗
PubMed2005

Multiple and interconnected pathways for L-lysine catabolism in Pseudomonas putida KT2440.

L-lysine catabolism in Pseudomonas putida KT2440 was generally thought to occur via the aminovalerate pathway. In this study we demonstrate the operation of the alternative aminoadipate pathway with the intermediates D-lysine, L-pipecolate, and aminoadipate. The simultaneous operation of both pathways for the use of L-lysine as the sole carbon and nitrogen source was confirmed genetically. Mutants with mutations in either pathway failed to use L-lysine as the sole carbon and nitrogen source, although they still used L-lysine as the nitrogen source, albeit at reduced growth rates. New genes were identified in both pathways, including the davB and davA genes that encode the enzymes involved in the oxidation of L-lysine to delta-aminovaleramide and the hydrolysis of the latter to delta-aminovalerate, respectively. The amaA, dkpA, and amaB genes, in contrast, encode proteins involved in the transformation of Delta1-piperidine-2-carboxylate into aminoadipate. Based on L-[U-13C, U-15N]lysine experiments, we quantified the relative use of pathways in the wild type and its isogenic mutants. The fate of 13C label of L-lysine indicates that in addition to the existing connection between the D- and L-lysine pathways at the early steps of the catabolism of L-lysine mediated by a lysine racemase, there is yet another interconnection at the lower end of the pathways in which aminoadipate is channeled to yield glutarate. This study establishes an unequivocal relationship between gene and pathway enzymes in the metabolism of L-lysine, which is of crucial importance for the successful colonization of the rhizosphere of plants by this microorganism.

2-Aminoadipic Acid↗
PubMed2004

Plant-associated Pseudomonas populations: molecular biology, DNA dynamics, and gene transfer.

Bacteria of the genus Pseudomonas are usual colonizers of plant leaves, roots, and seeds, establishing at relatively high cell densities on plant surfaces, where they aggregate and form microcolonies similar to those observed during biofilm development on abiotic surfaces. These plant-associated biofilms undergo chromosomal rearrangements and are hot spots for conjugative plasmid transfer, favored by the close proximity between cells and the constant supply of nutrients coming from the plant in the form of exudates or leachates. The molecular determinants known to be involved in bacterial colonization of the different plant surfaces, and the mechanisms of horizontal gene transfer in plant-associated Pseudomonas populations are summarized in this review.

Chromosomes, Bacterial↗
PubMed2004

Cell density-dependent gene contributes to efficient seed colonization by Pseudomonas putida KT2440.

We have characterized the expression pattern of a gene, ddcA, involved in initial colonization of corn seeds by Pseudomonas putida KT2440. The ddcA gene codes for a putative membrane polypeptide belonging to a family of conserved proteins of unknown function. Members of this family are widespread among prokaryotes and include the products of a Salmonella enterica serovar Typhimurium gene expressed during invasion of macrophages and psiE, an Escherichia coli phosphate starvation-inducible gene. Although its specific role is undetermined, the presence of ddcA in multicopy restored the seed adhesion capacity of a KT2440 ddcA mutant. Expression of ddcA is growth phase regulated, being maximal at the beginning of stationary phase. It is independent of RpoS, nutrient depletion, or phosphate starvation, and it is not the result of changes in the medium pH during growth. Expression of ddcA is directly dependent on cell density, being also stimulated by the addition of conditioned medium and of seed exudates. This is the first evidence suggesting the existence of a quorum-sensing system in P. putida KT2440. The potential implication of such a signaling process in seed adhesion and colonization by the bacterium is discussed.

Amino Acid Sequence↗
PubMed2004

The davDT operon of Pseudomonas putida, involved in lysine catabolism, is induced in response to the pathway intermediate delta-aminovaleric acid.

Pseudomonas putida KT2440 is a soil microorganism that attaches to seeds and efficiently colonizes the plant's rhizosphere. Lysine is one of the major compounds in root exudates, and P. putida KT2440 uses this amino acid as a source of carbon, nitrogen, and energy. Lysine is channeled to delta-aminovaleric acid and then further degraded to glutaric acid via the action of the davDT gene products. We show that the davDT genes form an operon transcribed from a single sigma70-dependent promoter. The relatively high level of basal expression from the davD promoter increased about fourfold in response to the addition of exogenous lysine to the culture medium. However, the true inducer of this operon seems to be delta-aminovaleric acid because in a mutant unable to metabolize lysine to delta-aminovaleric acid, this compound, but not lysine, acted as an effector. Effective induction of the P. putida P(davD) promoter by exogenously added lysine requires efficient uptake of this amino acid, which seems to proceed by at least two uptake systems for basic amino acids that belong to the superfamily of ABC transporters. Mutants in these ABC uptake systems retained basal expression from the davD promoter but exhibited lower induction levels in response to exogenous lysine than the wild-type strain.

Amino Acids, Neutral↗
PubMed2003

Transition from reversible to irreversible attachment during biofilm formation by Pseudomonas fluorescens WCS365 requires an ABC transporter and a large secreted protein.

We report the identification of an ATP-binding cassette (ABC) transporter and an associated large cell-surface protein that are required for biofilm formation by Pseudomonas fluorescens WCS365. The genes coding for these proteins are designated lap for large adhesion protein. The LapA protein, with a predicted molecular weight of approximately 900 kDa, is found to be loosely associated with the cell surface and present in the culture supernatant. The LapB, LapC and LapE proteins are predicted to be the cytoplasmic membrane-localized ATPase, membrane fusion protein and outer membrane protein component, respectively, of an ABC transporter. Consistent with this prediction, LapE, like other members of this family, is localized to the outer membrane. We propose that the lapEBC-encoded ABC transporter participates in the secretion of LapA, as strains with mutations in the lapEBC genes do not have detectable LapA associated with the cell surface or in the supernatant. The lap genes are conserved among environmental pseudomonads such as P. putida KT2440, P. fluorescens PfO1 and P. fluorescens WCS365, but are absent from pathogenic pseudomonads such as P. aeruginosa and P. syringae. The wild-type strain of P. fluorescens WCS365 and its lap mutant derivatives were assessed for their biofilm forming ability in static and flow systems. The lap mutant strains are impaired in an early step in biofilm formation and are unable to develop the mature biofilm structure seen for the wild-type bacterium. Time-lapse microscopy studies determined that the lap mutants are unable to progress from reversible (or transient) attachment to the irreversible attachment stage of biofilm development. The lap mutants were also found to be defective in attachment to quartz sand, an abiotic surface these organisms likely encounter in the environment.

ATP-Binding Cassette Transporters↗