Biomedical subjects

Mire Zloh

Publications and source records attributed to Mire Zloh.

10 recordsLinked to original sources

PubMed2006

Synthesis of DNA-directed pyrrolidinyl and piperidinyl confined alkylating chloroalkylaminoanthraquinones: potential for development of tumor-selective N-oxides.

A novel series of 1,4-disubstituted chloroethylaminoanthraquinones, containing alkylating chloroethylamino functionalities as part of a rigid piperidinyl or pyrrolidinyl ring-system, have been prepared. The target compounds were prepared by ipso-displacement of halides of various anthraquinone chromophores by either hydroxylated or chlorinated piperidinyl- or pyrrolidinyl-alkylamino side chains. The chloroethylaminoanthraquinones were shown to alkylate guanine residues of linearized pBR322 (1-20 microM), and two symmetrically 1,4-disubstituted anthraquinones (compounds 14 and 15) were shown to interstrand cross-link DNA in the low nM range. Several 1,4-disubstituted chloroethylaminoanthraquinones were potently cytotoxic (IC50 values: <or=40 nM) in human ovarian cancer A2780 cells. Two agents (compounds 18 and 19) exhibited mean GI50 values of 96 nM and 182 nM, respectively, in the NCI human tumor cell line panel. Derivatization of the potent DNA cross-linking agent 15 to an N-oxide resulted in loss of the DNA unwinding, DNA interstrand cross-linking and cytotoxic activity of the parent molecule.

Anthraquinones↗

PubMed2006

Spectral analysis of the DNA targeting bisalkylaminoanthraquinone DRAQ5 in intact living cells.

BACKGROUND: We report on the potential DNA binding modes and spectral characteristics of the cell-permeant far red fluorescent DNA dye, DRAQ5, in solution and bound within intact cells. Our aim was to determine the constraints for its use in flow cytometry and bioimaging. METHODS: Solution characteristics and quantum yields were determined by spectroscopy. DRAQ5 binding to nuclear DNA was analyzed using fluorescence quenching of Hoechst 33342 dye, emission profiling by flow cytometry, and spectral confocal laser scanning microscopy of the complex DRAQ5 emission spectrum. Cell cycle profiling utilized an EGFP-cyclin B1 reporter as an independent marker of cell age. Molecular modeling was used to explore the modes of DNA binding. RESULTS: DRAQ5 showed a low quantum yield in solution and a spectral shift upon DNA binding, but no significant fluorescence enhancement. DRAQ5 caused a reduction in the fluorescence intensity of Hoechst 33342 in live cells prelabeled with the UV excitable dye, consistent with molecular modeling that suggests AT preference and an engagement of the minor groove. In vivo spectral analysis of DRAQ5 demonstrated shifts to longer wavelengths upon binding with DNA. Analysis of spectral windows of the dual emission peaks at 681 and 707 nm in cells showed that cell cycle compartment recognition was independent of the far red-near IR emission wavelengths monitored. CONCLUSIONS: The study provides new clues to modes of DNA binding of the modified anthraquinone molecule in vivo, and its AT base-pair selectivity. The combination of low quantum yield but high DNA affinity explains the favorable signal-to-noise profile of DRAQ5-nuclear fluorescence. The robust nature of cell cycle reporting using DRAQ5, even when restricted spectral windows are selected, facilitates the analysis of encroaching spectral emissions from other fluorescent reporters, including GFP-tagged proteins.

Anthraquinones↗

PubMed2006

Site-specific PEGylation of native disulfide bonds in therapeutic proteins.

Native disulfide bonds in therapeutic proteins are crucial for tertiary structure and biological activity and are therefore considered unsuitable for chemical modification. We show that native disulfides in human interferon alpha-2b and in a fragment of an antibody to CD4(+) can be modified by site-specific bisalkylation of the two cysteine sulfur atoms to form a three-carbon PEGylated bridge. The yield of PEGylated protein is high, and tertiary structure and biological activity are retained.

Alkylation↗

PubMed2005

Efficient solid-phase-based total synthesis of the bisintercalator TANDEM.

[reaction: see text] In this article, the first solid-phase-based total synthesis of TANDEM, a synthetic analogue of triostin A, is described. In initial studies, the synthesis incorporated depsipeptide formation, introduction of chromophores, and disulfide bond formation on the solid phase, prior to a final solution-phase macrolactamization, to give the target molecule. Although pure TANDEM was obtained in an overall yield comparable to those for all syntheses to date, the yield of the final cyclization was low (11%). A more efficient approach involved removal from the solid phase prior to disulfide bond formation. The resulting linear peptide underwent macrolactamization under mild conditions and high dilution. Final disulfide bond formation was essentially quantitative and gave the target molecule, TANDEM, in an overall yield of 18%. The final compound was assessed for its ability to bind to 5'-TpA sequences on DNA by DNase I footprinting. This efficient synthesis sets the stage for a study of the structure-activity relationship of TANDEM and the natural product triostin A, with analogues containing "point mutations" at every site within the cyclic compounds.

Anti-Bacterial Agents↗

PubMed2005

Putative DNA quadruplex formation within the human c-kit oncogene.

The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.

Base Sequence↗

PubMed2005

Investigation of the association and flexibility of cationic lipidic peptide dendrons by NMR spectroscopy.

The cationic peptide dendrons synthesized and studied are lower generation polylysine-based partial dendrimers with or without lipid chains in the core. The dendrons with lipidic chains can be utilized as protein and liposomal mimics because of their unique structural properties. The full assignments of three different dendrons (L)7(NH2)8, (C14)1(L)7(NH2)8 and (C14)3(L)7(NH2)8 were obtained in D2O and H2O/D2O using a 500 MHz NMR spectrometer. The hydrophobic lipidic core of branched polylysine dendrons was found to induce aggregation upon increasing concentration. Because non-lipidic dendrons do not self-assemble, the behaviour and internal structural features of two different dendrons with one and three C14 hydrocarbon chains were explored. The critical association concentration clearly depends on the number of core hydrophobic residues and the association starts at 0.025 mM for (C14)1(L)7(NH2)8 and 0.05 mM for (C14)3(L(7(NH2)8. Chemical shift analysis also revealed that the hydrophobic chains of the dendrons associate in the core, whereas the polar head groups (NH2) are mainly located at the surfaces of the aggregates. The T1 relaxation time measurements showed that the mobility of the hydrocarbon chain is greater with the monomeric form of dendron (C14)1(L)7(NH2)8) than that of monomer (C14)3(L)7(NH2)8. The inter-chain hydrophobic interactions restrict the flexibility of the dendron with three hydrocarbon chains. As expected, the flexibility of the monomeric form is higher than that of the aggregated state for both of the dendrons.

Lipoproteins↗

PubMed2005

Isopimaric acid from Pinus nigra shows activity against multidrug-resistant and EMRSA strains of Staphylococcus aureus.

The diterpene isopimaric acid was extracted from the immature cones of Pinus nigra (Arnold) using bioassay-guided fractionation of a crude hexane extract. Isopimaric acid was assayed against multidrug-resistant (MDR) and methicillin-resistant Staphylococcus aureus (MRSA). The minimum inhibitory concentrations (MIC) were 32-64 microg/mL and compared with a commercially obtained resin acid, abietic acid, with MICs of 64 microg/mL. Resin acids are known to have antibacterial activity and are valued in traditional medicine for their antiseptic properties. These results show that isopimaric acid is active against MDR and MRSA strains of S. aureus which are becoming increasingly resistant to antibiotics. Both compounds were evaluated for modulation activity in combination with antibiotics, but did not potentiate the activity of the antibiotics tested. However, the compounds were also assayed in combination with the efflux pump inhibitor reserpine, to see if inhibition of the TetK or NorA efflux pump increased their activity. Interestingly, rather than a potentiation of activity by a reduction in MIC, a two to four-fold increase in MIC was seen. It may be that isopimaric acid and abietic acid are not substrates for these efflux pumps, but it is also possible that an antagonistic interaction with reserpine may render the antibiotics inactive. 1H-NMR of abietic acid and reserpine taken individually and in combination, revealed a shift in resonance of some peaks for both compounds when mixed together compared with the spectra of the compounds on their own. It is proposed that this may be due to complex formation between abietic acid and reserpine and that this complex formation is responsible for a reduction in activity and elevation of MIC.

Abietanes↗

PubMed2004

Inhibitors of multidrug resistance (MDR) have affinity for MDR substrates.

Multidrug-resistance (MDR) occurs in many bacterial species and tumour cells. MDR functions by membrane proteins which export drugs from cells, resulting in a low ineffective concentration of the drug. We have shown by molecular modelling that inhibitors of MDR have affinity for substrates of MDR transporters. This affinity may facilitate drug entry into cells and a large inhibitor-drug complex may be a poorer substrate for the MDR mechanism. This complex would effectively 'cloak' the drug rendering it unavailable for efflux.

ATP Binding Cassette Transporter, Subfamily B↗

PubMed2003

Solid-phase synthesis of the cyclic peptide portion of chlorofusin, an inhibitor of p53-MDM2 interactions.

The first solid-phase synthesis of the chlorofusin peptide is described. The synthesis involved side-chain immobilization of N(alpha)-Fmoc-Asp-ODmab. Synthesis of the linear peptide, initially incorporating racemic Ade8 and unsubstituted ornithine in place of the chromophore-bearing residue, was followed by cyclization on resin and peptide release to give a mixture of diastereomers. Resynthesis identified (by HPLC) the second isomer as analogous to the natural product. Initial biological assays, using an immunofluorescence method, suggest that the compounds are not cytotoxic but do not inhibit the p53/mdm2 interaction. [structure: see text]

Antineoplastic Agents↗

PubMedDate not supplied

Site-specific PEGylation of protein disulfide bonds using a three-carbon bridge.

The covalent conjugation of a functionalized poly(ethylene glycol) (PEG) to multiple nucleophilic amine residues results in a heterogeneous mixture of PEG positional isomers. Their physicochemical, biological, and pharmaceutical properties vary with the site of conjugation of PEG. Yields are low because of inefficient conjugation chemistry and production costs high because of complex purification procedures. Our solution to these fundamental problems in PEGylating proteins has been to exploit the latent conjugation selectivity of the two sulfur atoms that are derived from the ubiquitous disulfide bonds of proteins. This approach to PEGylation involves two steps: (1) disulfide reduction to release the two cysteine thiols and (2) re-forming the disulfide by bis-alkylation via a three-carbon bridge to which PEG was covalently attached. During this process, irreversible denaturation of the protein did not occur. Mechanistically, the conjugation is conducted by a sequential, interactive bis-alkylation using alpha,beta-unsaturated beta'-monosulfone functionalized PEG reagents. The combination of (a) maintaining the protein's tertiary structure after disulfide reduction, (b) the mechanism for bis-thiol selectivity of the PEG reagent, and (c) the steric shielding of PEG ensure that only one PEG molecule is conjugated at each disulfide bond. PEG was site-specifically conjugated via a three-carbon bridge to 2 equiv of the tripeptide glutathione, the cyclic peptide hormone somatostatin, the tetrameric protein l-asparaginase, and to the disulfides in interferon alpha-2b (IFN). SDS-PAGE, mass spectral, and NMR analyses were used to confirm conjugation, thiol selectivity, and connectivity. The biological activity of the l-asparaginase did not change after the attachment of four PEG molecules. In the case of IFN, a small reduction in biological activity was seen with the single-bridged IFN (without PEG attached). A significantly larger reduction in biological activity was seen with the three-carbon disulfide single-bridged PEG-IFNs and with the double-bridged IFN (without PEG attached). The reduction of the PEG-IFN's in vitro biological activity was a consequence of the steric shielding caused by PEG, and it was comparable to that seen with all other forms of PEG-IFNs reported. However, when a three-carbon bridge was used to attach PEG, our PEG-IFN's biological activity was found to be independent of the length of the PEG. This property has not previously been described for PEG-IFNs. Our studies therefore suggest that peptides, proteins, enzymes, and antibody fragments can be site-specifically PEGylated across a native disulfide bond using three-carbon bridges without destroying their tertiary structure or abolishing their biological activity. The stoichiometric efficiency of this approach also enables recycling of any unreacted protein. It therefore offers the potential to make PEGylated biopharmaceuticals as cost-effective medicines for global use.

Alkylation↗