Genetic influences on bone turnover, bone density and fracture.
Explore the source record for details and available documents.
Aging↗
Biomedical subjects
N A Morrison
Publications and source records attributed to N A Morrison.
Vitamin D receptor genotypes in osteoporosis.
Explore the source record for details and available documents.
Genotype↗
Prediction of bone density from vitamin D receptor alleles.
Bone density achieved in early adulthood is the major determinant of risk of osteoporotic fracture. Up to 60% of women suffer osteoporotic fractures as a result of low bone density, which is under strong genetic control acting through effects on bone turnover. Here we show that common allelic variants in the gene encoding the vitamin D receptor can be used to predict differences in bone density, accounting for up to 75% of the total genetic effect on bone density in healthy individuals. The genotype associated with lower bone density was overrepresented in postmenopausal women with bone densities more than 2 standard deviations below values in young normal women. The molecular mechanisms by which bone density is regulated by the vitamin D receptor gene are not certain, although allelic differences in the 3' untranslated region may alter messenger RNA levels. These findings could open new avenues to the development and targeting of prophylactic interventions. It follows that other pathophysiological processes considered to be subject to complex multifactorial genetic regulation may also be modulated by a single gene with pleiotropic transcriptional actions.
Adolescent↗
Transcriptional activation of the human osteocalcin gene by basic fibroblast growth factor.
Basic fibroblast growth factor (bFGF) has been detected in bone cells and stimulates osteoblast proliferation; however, its role in the regulation of bone metabolism remains speculative. We demonstrated that the human osteocalcin promoter is activated by bFGF when transfected into rat osteoblastic (ROS 17/2.8) cells. This effect is concentration dependent, with a twofold induction at 10 ng/ml detected after 20 h. The bFGF response is independent of both the 1,25-dihydroxyvitamin D3 [1,25-(OH)2D3] and retinoic acid activation of the osteocalcin promoter. To identify the promoter sequences through which bFGF exerts its effect, we tested a series of promoter deletion constructs for their response to bFGF. Deletion of the upstream region between -673 and -588 bp results in a significant loss of induction. Gel-shift analysis demonstrates that proteins present in ROS 17/2.8 nuclear extracts bind specifically to these sequences. This region alone was unable to confer the bFGF response on a minimal osteocalcin or an heterologous promoter. However, sequences between -678 and -476 bp, which also includes the vitamin D response element (VDRE), were able to confer bFGF inducibility on both a minimal osteocalcin and a heterologous promoter. These data suggest that induction of the human osteocalcin promoter by bFGF requires the interaction of more than one sequence element.
Animals↗
Vitamin D receptor alleles and bone physiology.
The vitamin D endocrine system is central to the control of bone and calcium homeostasis. The active hormonal form of vitamin D, 1,25 dihydroxyvitamin D (calcitriol), the circulating level of which is tightly regulated, acts through a specific receptor to mediate its genomic actions on almost every aspect of calcium homeostasis. Because of its transactivation function, it is possible that a small difference in vitamin D receptor level could be amplified into a biologically significant alteration in physiological setpoint. The recent finding that polymorphisms in the vitamin D receptor gene are predictive of bone density (Morrison et al., Nature 367:284-287, 1994) is the first example of an allelic effect in such a homeostatically controlled system. This raises the possibility that such central operators may exist in other regulatory pathways, and could explain a large part of the observed "normal" population distribution that exists for all physiological parameters.
Alleles↗
Ketorolac versus acetaminophen or ibuprofen in controlling postoperative pain in patients with strabismus.
PURPOSE: Ketorolac is a new, parenteral, nonsteroidal, anti-inflammatory agent. The authors compare the effectiveness of a single intravenous dose of ketorolac with a single oral dose of either acetaminophen or ibuprofen in controlling postoperative pain in patients with strabismus. METHODS: A prospective, randomized, double-masked study was performed on 60 patients older than 12 years of age who were undergoing strabismus surgery. The patients were randomized into one of three single-dosage treatment groups: group 1 received oral acetaminophen (650 mg); group 2 received oral ibuprofen (600 mg); and group 3 received intravenous ketorolac (60 mg) intraoperatively and placebo capsules postoperatively. Pain and sedation levels were assessed at 2 and 5 hours after surgery by having the patient mark a standard 100-mm visual analog scale. RESULTS: The ketorolac-treated patients had significantly less pain at both the 2- and 5-hour intervals after surgery compared with either the acetaminophen or ibuprofen groups (P = 0.001). There was no difference in the level of sedation among any of the three treatment groups. CONCLUSION: Intravenous ketorolac given at the conclusion of surgery was more effective than either oral acetaminophen or oral ibuprofen given 30 to 45 minutes after strabismus surgery in controlling postoperative pain. Pain relief was achieved earlier by intravenous delivery than by oral agents. Greater pain relief with ketorolac was sustained 5 hours after surgery. This facilitates suture adjustment and earlier discharge. Similar pain control is possible for other ophthalmologic surgery. Because the oral medications used in this study were administered in capsules, the results may have been different if clinically available preparations had been tested.
Acetaminophen↗
Genetics of osteoporosis.
Identification of the major contribution of genetic factors in determination of peak bone mass at skeletal maturity and possibly on subsequent age-related bone loss has led to efforts to identify possible mechanisms. Recent evidence suggests one mechanism relates to genetic effects on bone turnover mediated via the vitamin D system. This field of research has potential for reducing osteoporotic fracture risk by allowing interventions at different stages in life to reduce this increasing problem of ageing societies.
Aging↗
Genetic influences on type I collagen synthesis and degradation: further evidence for genetic regulation of bone turnover.
Circulating osteocalcin, a marker of bone formation, is under strong genetic influence, and this effect is related to the genetic influence on bone density. To examine genetic influences on bone turnover further, other markers of bone formation (serum carboxyterminal propeptide of type I procollagen, PICP), bone resorption (serum pyridinoline cross-linked carboxyterminal telopeptide of type I collagen, ICTP), and nonosseous connective tissue synthesis (serum aminoterminal propeptide of type III procollagen, PIIINP) were studied in 82 female twin pairs: 42 monozygotic (MZ) and 40 dizygotic (DZ) twin pairs (mean age, MZ; 48.4 yr; DZ; 45.6 yr). The intraclass correlation coefficients of MZ twin pairs, rMZ, for serum PICP (0.78) and serum ICTP (0.68) were significantly greater than the corresponding rDZ (0.31 and 0.36, respectively), but a genetic effect on serum PIIINP was not demonstrable. Within DZ twin pair differences in serum PICP predicted differences in lumbar spine bone density (r = -0.37); higher serum PICP levels indicating the twin with the lower lumbar spine bone density. Also within pair differences in serum ICTP and PICP predicted differences in bone density at the lumbar spine independent of serum osteocalcin. These data indicate that both synthesis and degradation of type I collagen are genetically determined and that this phenomenon is related to the genetic regulation of bone density.
Analysis of Variance↗
Peak bone mass and osteoporosis prevention.
The incidence of osteoporotic fractures increases with advancing age. Despite advances in therapy, reversal of bone loss in established osteoporosis remains problematic and deformities and disability due to fractures often persist. Therefore the logical approach to osteoporosis treatment is preventive. Risk of fracture is determined largely by bone density, which is the end result of peak value achieved at skeletal maturity and subsequent age- and menopause-related bone loss. Thus the determinants of peak bone density and bone loss require full characterization. Environmental and lifestyle factors are important determinants of bone density, particularly physical activity and diet. For example, muscle strength and physical fitness predict bone density, so that regular moderate exercise may help maintain bone mass but probably does not reverse loss. Long-term calcium intake appears to be important for achievement and maintenance of peak bone density, especially in males. Smoking and excessive alcohol intake are deleterious to bone mass. Cultural norms in diet, lifestyle and physical activity obviously have an impact on bone density. Genetic factors have a strong role in determining the wide range in 'normal' peak bone mass. Moreover we have found strong genetic determinants of rates of change of bone mass in the lumbar spine and similar trends for sites in the femoral neck. We have shown previously that genetic factors influence bone turnover indices, particularly osteocalcin. Investigating these relationships with restriction fragment length polymorphisms, we have identified variants of the vitamin D receptor gene which predict osteocalcin levels and presumably bone turnover.(ABSTRACT TRUNCATED AT 250 WORDS)
Aging↗
Contribution of trans-acting factor alleles to normal physiological variability: vitamin D receptor gene polymorphism and circulating osteocalcin.
Osteocalcin, the most abundant noncollagenous protein in bone, is a marker of bone turnover in normal and disease states. Its synthesis is induced by calcitriol, the active hormonal form of vitamin D, through the vitamin D receptor and a specific vitamin D-responsive element in the osteocalcin gene promoter. Serum concentrations of osteocalcin are under strong genetic influence. To ascertain whether variability in circulating osteocalcin levels may reflect allelic variation in the vitamin D receptor gene, we have analyzed the relationship between frequent restriction fragment length polymorphisms (RFLPs, detected by endonucleases Bsm I, EcoRV, and Apa I) that define human vitamin D receptor alleles and serum osteocalcin in a cohort of normal subjects. In 91 Caucasian subjects, RFLPs in the vitamin D receptor gene predicted circulating osteocalcin levels (P less than 0.0001) independent of age or menopause effects. Since the osteocalcin gene and the vitamin D receptor gene are encoded on different chromosomes, the interaction between these two genes occurs in trans. Thus, common alleles of this trans-acting factor, the vitamin D receptor, are functionally different and contribute to "normal" physiological variability in osteocalcin levels. Preliminary analysis in monozygotic and dizygotic twin pairs indicates that the greater diversity in lumbar spine density between the dizygotic pairs can be explained by divergence in vitamin D receptor alleles. Variations in this receptor and other transacting factor genes may confound physiological studies of regulation of target genes and will need to be considered in future human and animal studies. This approach to genetic analysis provides a paradigm for the study of functional variation in trans-acting factors and the role such variation may play in the generation and evolution of physiological diversity.
Alleles↗
Nonhypercalcemic 1,25-(OH)2D3 analogs potently induce the human osteocalcin gene promoter stably transfected into rat osteosarcoma cells (ROSCO-2).
1,25-Dihydroxyvitamin D3 [1,25-(OH)2D3] is the active hormonal form of vitamin D3 and has potent effects on bone and calcium regulation. Over the past decade it has become apparent that 1,25-(OH)2D3 has other effects on cellular proliferation that potentially could be developed for therapy in human malignancy. Since the hypercalcemic effects of 1,25-(OH)2D3 have limited that use in the human, novel nonhypercalcemic analogs of 1,25-(OH)2D3 have been synthesized. The molecular mechanism of this divergence in these antiproliferative and calcium-regulating actions is unexplained. We have previously examined the human bone-specific gene osteocalcin as a model of the molecular mechanisms of vitamin D action in bone and have shown that induction of the osteocalcin gene by 1,25-(OH)2D3 is mediated through an unique and complex palindromic region of the promoter similar to but distinct from those of other steroid hormone-responsive elements. Using an osteosarcoma cell line permanently transfected with the vitamin D-responsive promoter of the human osteocalcin gene linked to a "reporter" gene, we have shown that there is a dose-dependent induction of CAT activity by 1,25-(OH)2D3 and that the potencies of vitamin D metabolites and analogs are comparable to those found in other vitamin D bioassays. Furthermore, vitamin D analogs, including MC-903, 22-oxa-1,25-(OH)2D3, and delta 22-1,25S,26-trihydroxyvitamin D3, which effect cellular differentiation but lack hypercalcemic activity in vivo, exhibit osteocalcin promoter inductive actions virtually identical to those of 1,25-(OH)2D3. Consideration of these and other data support the hypothesis that the divergent effects of such analogs on differentiation and calcium homeostasis reflect pharmacokinetic differences in vivo rather than distinct 1,25-(OH)2D3-sensitive pathways.
Animals↗
Methicillin-resistant Staphylococcus aureus corneal ulcers.
Three patients with corneal ulcers had gram-positive cocci isolated on initial scrapings. There was no response to topical fortified aminoglycosides or cephalosporins. Cultures revealed methicillin-resistant Staphylococcus aureus that was sensitive only to topical vancomycin eye drops. Because the microbiologic spectrum is similar, vancomycin should be considered instead of a cephalosporin in the treatment of corneal ulcers to cover methicillin-resistant S. aureus and S. epidermidis.
Aged↗
1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene.
The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.
Animals↗
ApaI dimorphism at the human vitamin D receptor gene locus.
Explore the source record for details and available documents.
Animals↗
Development and differentiation of the root nodule. Involvement of plant and bacterial genes.
Explore the source record for details and available documents.
Cell Differentiation↗
Human natriuretic peptides (ANP) gene locus: BsmI RFLP.
Explore the source record for details and available documents.
Atrial Natriuretic Factor↗
Nodulin-26, a peribacteroid membrane nodulin is expressed independently of the development of the peribacteroid compartment.
The peribacteroid membrane (pbm) of root nodules is derived from the plant cell plasma membrane but contains in addition several nodule-specific host proteins (nodulins). Antibodies raised against purified pbm of soybean were used to immunoprecipitate polysomes to isolate an RNA fraction that served as a template for the synthesis of a cDNA probe for screening a nodule-specific cDNA library. Clone p1B1 was found to encode a 26.5 kDa polypeptide (nodulin-26) which is immunoprecipitable specifically with the anti-pbm serum. Nodulin-26 has features of a transmembrane protein and its structure differs from that of nodulin-24 which appears to be a surface protein of pbm. The expression of these two pbm nodulins was examined in nodules induced by Bradyrhizobium japonicum Tn5 mutants that arrest nodule development at different stages of pbm biosynthesis. Nodules that do not show release of bacteria from the infection thread express nodulin-24 at a very low level. In contrast, the expression of nodulin-26 occurs fully in nodules that form infection threads only and is not affected by the release of bacteria from the threads.
Amino Acid Sequence↗
Mobilization of a Sym plasmid from a fast-growing cowpea Rhizobium strain.
A large Sym plasmid from a fast-growing cowpea Rhizobium species was made mobilizable by cointegration with plasmid pSUP1011, which carries the oriT region of RP4. This mobilizable Sym plasmid was transferred to a number of Rhizobium strains, in which nodulation and nitrogen fixation functions for symbiosis with plants of the cowpea group were expressed.
Conjugation, Genetic↗