PubMed Health⌕ Search

Biomedical subjects

N Davidson

Publications and source records attributed to N Davidson.

At least 235 records · Page 13Linked to original sources

Sequence arrangement and biological activity of cloned feline leukemia virus proviruses from a virus-productive human cell line.

We examined 14 different feline leukemia virus proviruses from the productively infected human cell line RD(FeLV)-2 after cloning in the modified lambda vector Charon 4A. Each isolate was characterized by restriction digestion and Southern blot analysis. The DNA of each isolate was tested for competence to express virus after uptake by sensitive animal cells (transfection). All but one isolate contained an apparently complete provirus, but only four were infectious. Seven isolates (four noninfectious, three infectious) were studied by heteroduplexing followed by electron microscopy or by S1 nuclease treatment and gel electrophoresis. No regions of nonhomology between proviruses were detected by either criterion, and in no case did we observe homology between flanking sequences. Random shearing or removal of flanking sequences by S1 nuclease had no effect on the status of infectivity of the clones. Thus, we were unable to find molecular differences between infectious and noninfectious proviruses. Our data are consistent with either of the following hypotheses: (i) that there is a short host sequence which is essential as a promoter for virus expression; or (ii) that lack of infectivity is due to small mutations within the proviral genome.

Base Sequence↗

Isolation and characterization of the dopa decarboxylase gene of Drosophila melanogaster.

We have isolated chromosomal deoxyribonucleic acid clones containing the Drosophila dopa decarboxylase gene. We describe an isolation procedure which can be applied to other nonabundantly expressed Drosophila genes. The dopa decarboxylase gene lies within or very near polytene chromosome band 37C1-2. The gene is interrupted by at least one intron, and the primary mode of regulation is pretranslational. At least two additional sequences hybridized by in vivo ribonucleic acid-derived probes are found within a 35-kilobase region surrounding the gene. The developmental profile of ribonucleic acid transcribed from one of these regions differs from that of the dopa decarboxylase transcript.

Animals↗

Cottage hospitals: the charm has gone but the loyalties remain.

'You can't have a resort like this without a hospital,' argued a consultant at Tenby Cottage Hospital when Nick Davidson visited recently. But some staff members hold ambiguous attitudes to the building itself. Indeed, one would like to pull it down and replace it with a modern, purpose-built building.

England↗

Two drosophila melanogaster tRNAGly genes are contained in a direct duplication at chromosomal locus 56F.

One Drosophila melanogaster tRNAGly gene occurs on each 1.1-2.0 kb unit of a direct duplication at chromosomal region 56F. The nucleotide sequence of the gene and the 5' flanking region has been determined. The non-transcribed strand sequence of the tRNA gene is: 5' GCATCGGTGGTTCAGTGGTAGAATGCTCGCCTGCCACGCGGGCGGCCCGGGTTCGATTCCCGGCCGATGCA 3'. This nucleotide sequence is identical to that of the major glycine tRNA in Bombyx mori posterior silk gland. Within the 22 kb region mapped, additional tRNA genes are found, an observation consistent with reports that genes for other isoacceptors are present at this locus.

Animals↗

The baboon endogenous virus genome. II. Provirus sequence variations in baboon cell DNA.

Restriction analysis of the approximately 100 integrated baboon endogenous virus (BaEV) proviruses in baboon cells and tissues has revealed two major sequence variations, both in the gag gene region of the genome. One, a 150 nucleotide pair insert, is present in a small proportion of the proviral DNAs and some baboons, but is present in the majority of the proviral DNAs of other baboons. The second, a Bam HI recognition sequence located 2.25 kb from the proviral 5' end, is missing or modified in approximately one-half of the integrated genomes. We consider the possibility that accumulation of proviruses not containing the 0.15 kb insert is correlated with viral activation and expression since it is this form that is a replication intermediate in freshly infected permissive cells. It is evident from these initial studies that the organization of the multiple BaEV proviruses in baboon DNA has undergone modification during evolution.

Animals↗

Cottage hospitals: a place in the country that is not entirely countrified.

They built a monument to the venerable Dr William Irvine, and they called it Irvine Memorial Hospital. Eighty years on, it lives up to his good name. There is no call to rusticate at this haven of healing in Scotland's tourist belt. Life is not all a summer idyll, as Nick Davidson discovered.

Hospital Bed Capacity, under 100↗

Sequence organization of feline leukemia virus DNA in infected cells.

A restriction site map has been deduced of unintegrated and integrated FeLV viral DNA found in human RD cells after experimental infection with the Gardner-Arnstein strain of FeLV. Restriction fragments were ordered by single and double enzyme digests followed by Southern transfer (1) and hybridization with 32P-labeled viral cDNA probes. The restriction map was oriented with respect to the 5' and 3' ends of viral RNA by using a 3' specific hybridization probe. The major form of unintegrated viral DNA found was a 8.7 kb linear DNA molecule bearing a 450 bp direct long terminal redundancy (LTR) derived from both 5' and 3' viral RNA sequences. Minor, circular forms, 8.7 kb and 8.2 kb in length were also detected, the larger one probably containing two adjacent copies of the LTR and the smaller one containing one comtaining one copy of the LTR. Integrated copies of FeLV are colinear with the unintegrated linear form and contain the KpnI and SmaI sites found in each LTR.

Animals↗

Cottage hospitals: small is beautiful.

A very ordinary, and for that reason much loved, cottage hospital in Tarporley, Cheshire, is the latest stopping off point for Nick Davidson on his tour of Britain. Surrounded by beautiful countryside and large stud farms the War Memorial Hospital is perhaps the smallest in Britain.

England↗

Cottage hospitals: beautiful isles with an air of fiction.

Continuing our series on cottage hospitals Nick Davidson visited St Mary's Hospital in the Isles of Scilly and found himself surrounded by breathtaking beauty. The hospital, which is practically self-sufficient in vegetables, is run by a nursing officer who believes in 'people not machines', and most casualties are treated for sunburn or the removal of fish hooks.

Health Facilities↗

Cottage hospitals: an evident future.

When Nick Davidson visited the Yeatman Cottage Hospital in Sherborne, Dorset, he found a beautiful country town with a history and a hospital with its roots in the past. It has grown to be not only part of the present, but a model for the future. As he toured Sherborne Abbey, in the process of restoration thanks to the public's generosity, he reflected on the town's other 'good cause'--the Yeatman Cottage Hospital.

England↗

Cottage hospitals: singing the praises of an unsung gem of the NHS.

You are not a mere case, or number, or symptom at Lynton Cottage Hospital in Devon. You are, in the words of Pauline Garnham, its matron, a "whole person'. Nick Davidson drove down the village high street with Mrs. Garnham. It was, he writes, like a royal procession. A wave here, a nod there: no chance of being inconspicuous in a world whose smallness is its endearing, not to say enduring, beauty.

England↗

Cottage hospitals: Cranleigh's loyal army keeps its history alive.

It never called itself a cottage hospital, but it started the cottage hospital movement which gave Britain a network of small hospitals unique in the world. Nick Davidson visits Cranleigh Village Hospital for the first article in a series on the small hospitals now once more in favour, as the reaction sets in against the cult of bigness.

England↗

RAWP: the honeymoon is over.

The Rawp honeymoon is over, the Government has seen to that. Nick Davidson asks some questions about the last couple of years of resource allocation and considers the effects of the new austerity on Sunderland, one of the biggest Rawp gaining areas, if such things still exist.

England↗

Health administration: sensible medicine not radical surgery for NHS ills.

In Nick Davidson's second article on government expectations for saving 30m pounds by streamlining NHS administration, he looks at non-management costs and asks what kind of savings could be made. He examines Beckenham Hospital's savings committee which is exploring methods of cutting costs without affecting patient services.

Cost Control↗

The gross anatomy of a tRNA gene cluster at region 42A of the D. melanogaster chromosome.

The sequence organization and positions of the tRNA genes in a tRNA gene cluster at chromosomal region 42A of the D. melanogaster (Dm) genome have been studied by recombinant DNA methods. A set of overlapping inserts of Dm DNA cloned in a lambdoid vector and extending in both directions from the Drosophila tRNA gene-bearing fragment of plasmid pCIT12 has been isolated by the procedure of "chromosomal walking." The isolated region has a total length of 94 kb of which a central 46 kb region contains eight tRNAAsn genes, four tRNA2Arg genes, five tRNA2Lys genes and one tRNAIle gene. The genes are irregularly spaced and transcribed from both strands; they occur to some extent in subclusters. Thus this sequence organization is totally different from the tandem repeat organizaiton seen in many 5S rRNA gene clusters of higher eucaryotes and in one Xenopus rRNA gene clusters of higher eucaryotes and in one Xenopus tRNA gene cluster.

Animals↗

The actin genes of Drosophila: a dispersed multigene family.

We have initiated a study of the organization and expression of the actin genes of D. melanogaster. Using actin gene-specific probes from both chicken and Dictyostelium sources, a clone--denoted lambda DmA2--containing a Drosophila actin gene has been isolated from a representative library of Drosophila genomic DNA cloned in the lambda bacteriophage vector, Charon 4. Southern blotting experiments reveal that there is only one actin structural gene contained in the 17.5 kb Drosophila insert of lambda DmA2 and that the sequences immediately flanking the structural gene are single copy. Observations by electron microscopy of the R loop structures formed by hybridizing total cytoplasmic poly(A)+ RNA from Drosophila embryos to an appropriate subcloned segment of lambda DmA2 indicate that the gene consists of an approximately 70-170 nucleotide leader sequence encoding the 5' portion of the mature mRNA, a 1.65 kb intervening sequence not present in the mRNA and a 1.55 kb sequence containing the major portion of the gene. Using genomic blots with actin-specific probes derived from lambda DmA2, we show that there are six actin genes per haploid Drosophilia genome. They direct the synthesis of three major size classes of mRNA. Using in situ hybridization, the six genes have been localized to six widely dispersed sites on the polytene chromosomes; the locus for lambda DmA2 is 5C on the X chromosome. In vitro translation of mRNA selected hybridization by a DNA segment specific to lambda DmA2 suggests that this particular gene codes for one of the cytoplasmic actin polypeptides.

Actins↗