PubMed Health⌕ Search

Biomedical subjects

N Delihas

Publications and source records attributed to N Delihas.

At least 37 records · Page 2Linked to original sources

Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs.

In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

Animals↗

Characterization of RNA-protein interactions in 7 S ribonucleoprotein particles from Xenopus laevis oocytes.

5 S RNA interactions with transcription factor protein A (TFIIIA) in 7 S particles from Xenopus laevis oocytes (Xlo) have been characterized by the use of an in vitro RNA exchange assay. 32P-labeled Xlo 5 S RNA can rapidly be incorporated into 7 S particles by simple incubation of the RNA with intact particles. Incorporation of the labeled RNA during exchange reaches an equilibrium within 20 min at 20 degrees C. Labeled Xlo 5 S RNA already incorporated in 7 S particles can be chased out by an excess of unlabeled 5 S RNA. Nondenaturing gel electrophoresis of 7 S particle samples segregates several ribonucleoprotein particles containing TFIIIA and 5 S RNA. Time course experiments reveal incorporation of 32P-labeled 5 S RNA first in a higher molecular weight ribonucleoprotein particle before incorporation into the 7 S particle. In the exchange process, the integrity of the higher order structure of the RNA is essential for a recognition of the 5 S RNA by TFIIIA. Denatured Xlo 5 S RNA exchanges poorly in the presence of EDTA, but can exchange into the particle at a high level if sufficient divalent cations are present to allow the higher order structure of the RNA to reform. Xlo 5 S RNA fragments that have the 5' or 3' ends deleted past helix I markedly lose their ability to exchange. Heterologous eukaryotic and eubacterial 5 S RNAs can exchange into 7 S particles, although the eubacterial 5 S RNAs exchange at a low level.

Animals↗

Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences.

The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of our obtaining these new sequences is that we are able to clarify the phylogenetic origins of the plant mitochondrion. In particular, we find a close phylogenetic relationship between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

Base Sequence↗

5S RNA structure and interaction with transcription factor A. 1. Ribonuclease probe of the structure of 5S RNA from Xenopus laevis oocytes.

The structure of Xenopus laevis oocyte (Xlo) 5S ribosomal RNA has been probed with single-strand-specific ribonucleases T1, T2, and A with double-strand-specific ribonuclease V1 from cobra venom. The digestion of 5'- or 3'-labeled renatured 5S RNA samples followed by gel purification of the digested samples allowed the determination of primary cleavage sites. Results of these ribonuclease digestions provide support for the generalized 5S RNA secondary structural model derived from comparative sequence analysis. However, three putative single-stranded regions of the molecule exhibited unexpected V1 cuts, found at C36, U73, U76, and U102. These V1 cuts reflect additional secondary structural features of the RNA including A.G base pairs and support the extended base pairing in the stem containing helices IV and V which was proposed by Stahl et al. [Stahl, D. A., Luehrsen, K. R., Woese, C. R., & Pace, N. R. (1981) Nucleic Acids Res. 9, 6129-6137]. A conserved structure for helix V having a common unpaired uracil residue at Xlo position 84 is proposed for all eukaryotic 5S RNAs. Our results are compared with nuclease probes of other 5S RNAs.

Animals↗

5S RNA structure and interaction with transcription factor A. 2. Ribonuclease probe of the 7S particle from Xenopus laevis immature oocytes and RNA exchange properties of the 7S particle.

The 5S RNA complexed in the 7S particle of immature Xenopus laevis oocytes was 32P labeled at its 3' end and then subjected in situ to partial digestion using ribonucleases T1, T2, A, and V1 in order to study the conformation of the complexed RNA and its interaction with the transcription factor A (TFIIIA). Digested samples were gel purified to retrieve 5S RNA that was still complexed with the transcription factor protein, and the cleavages in these RNAs were analyzed on sequencing gels. The RNA associated with the 7S particle is very susceptible to ribonuclease activity despite the presence of the protein. Also, the 5S RNA in the 7S particle is in a different conformation from renatured Xenopus laevis (Xlo) 5S RNA and appears to have less secondary structure predominantly in the stem that includes helices IV and V. A species of native Xlo 5S RNA which was isolated from 7S particle preparations under nondenaturing conditions revealed a conformation that was more similar to the 5S RNA in the 7S particle than to renatured 5S RNA. Comparison of data from partial ribonuclease digestions performed on renatured 5S RNA, on the native 5S RNA, and on the complexed 5S RNA allowed us to approximate sites of protein-induced structural change in the complexed 5S RNA, which may signal protein interaction domains. These sites include the 5' side of helices III and V. In another approach to the study of 5S RNA-TFIIIA interactions, we have observed that incubation of 32P-labeled Xlo 5S RNA with 7S particles results in the incorporation of labeled RNA into 7S particles.(ABSTRACT TRUNCATED AT 250 WORDS)

Animals↗

Unusual structural features of the 5S ribosomal RNA from Streptococcus cremoris.

The nucleotide sequence of the 5S ribosomal RNA of Streptococcus cremoris has been determined. The sequence is 5' (sequence in text) 3'. Comparison of the S. cremoris 5S RNA sequence to an updated prokaryotic generalized 5S RNA structural model shows that this 5S RNA contains some unusual structural features. These features result largely from uncommon base substitutions in helices I, II and IV. Some of these unusual structural features are shared by several of the known 5S RNA sequences from mycoplasmas. However, the characteristic bloc of deletions found in helix V of these mycoplasma 5S RNAs is not present in the 5S RNA of S. cremoris.

Base Sequence↗

Analysis of the base substitutions found in the Xenopus laevis 5 S RNA pseudogene.

A 5 S RNA pseudogene is associated with the major oocyte 5 S RNA gene of Xenopus laevis. X. borealis has several oocyte specific 5 S RNA genes. Gene 1 is the dominant 5 S RNA gene. Gene 3 has sometimes been referred to as a pseudogene. We show that the base substitutions in the X. laevis 5 S pseudogene are non-random with respect to double and single-stranded regions of the 5 S RNA using the chi 2 test of homogeneity with Yates correction for continuity. In addition, conserved positions of eukaryotic 5 S RNAs are predominantly maintained. X. borealis gene 3 is random in mutations.

Animals↗

Generalized structures of the 5S ribosomal RNAs.

The sequences of 5S ribosomal RNAs from a wide-range of organisms have been compared. All sequences fit a generalized 5S RNA secondary structural model. Twenty-three nucleotide positions are found universally, i.e., in 5S RNAs of eukaryotes, prokaryotes, archaebacteria, chloroplasts and mitochondria. One major distinguishing feature between the prokaryotic and eukaryotic 5S RNAs is the number of nucleotide positions between certain universal positions, e.g., prokaryotic 5S RNAs have three positions between the universal positions PuU40 and G44 (using the E. coli numbering system) and eukaryotic 5S RNAs have two. The archaebacterial 5S RNAs appear to resemble the eukaryotic 5S RNAs to varying degrees depending on the species of archaebacteria although all the RNAs conform with the prokaryotic "rule" of chain length between PuU40 and G44. The green plant chloroplast and wheat mitochondrial 5S RNAs appear prokaryotic-like when comparing the number of positions between universal nucleotides. Nucleotide positions common to eukaryotic 5S RNAs have been mapped; in addition, nucleotide sequences, helix lengths and looped-out residues specific to phyla are proposed. Several of the common nucleotides found in the 5S RNAs of metazoan somatic tissue differ in the 5S RNAs of oocytes. These changes may indicate an important functional role of the 5S RNA during oocyte maturation.

Animals↗

On the phylogeny of Phycomyces blakesleeanus. Nucleotide sequence of 5 S ribosomal RNA.

The nucleotide sequence of the major 5 S ribosomal RNA from the lower fungus Phycomyces blakesleeanus has been determined. The sequence is 5' AAUCUACGGCCAUACAGAUAGUAACACACCGGAUCCCGUCUGAUCUCCGCAGUUAAGUCUCUCCUGGUAGCGUCAGUAC UAUGGUGGGGGACCACAUGGGAAUACGCUAUGUCGUAGGUU3'OH. The Phycomyces 5 S RNA sequence has invariant nucleotide positions characteristic of other eukaryotic 5 S RNAs and fits currently proposed secondary structural models. The Phycomyces of 5 S RNA shows relatively low overall sequence homology to the higher fungal (Ascomycetes) 5 S RNAs (56-60%) but shows higher sequence homology to those 5 S RNAs from Tetrahymena thermophila (68%), human KB cells (67%), and Spinacia oleracea (62%). A comparison of individual segments of the RNA also shows that the structure of Phycomyces 5 S RNA has several major differences from structures common to the higher fungi. Positions 2-14 are homologous with those of metazoan and some protozoan 5 S RNAs. At positions 30-45, the RNA sequence is closer to metazoan 5 S RNAs than to the Neurospora of Aspergillus 5 S RNAs. The Phycomyces 5 S RNA shares similar sequences with both Aspergillus and Tetrahymena 5 S RNAs at positions 79-99. Several other important homologies in primary and proposed secondary structures also have been observed in comparing Phycomyces 5 S RNA with animal and plant 5 S RNAs. We conclude that Phycomyces may not be as closely related phylogenetically to the Ascomycetes as previously thought.

Base Sequence↗

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.

Animals↗

The nucleotide sequence of spinach cytoplasmic 5 S ribosomal RNA.

The nucleotide sequence of the cytoplasmic 5 S ribosomal RNA from Spinacia oleracea has been determined. A secondary structural model possessing four base-paired regions can be constructed from the primary structure. This RNA shows 90 to 93% nucleotide sequence homology with other higher plant cytoplasmic 5 S RNAs and 73% homology with that of the lower eukaryote Chlorella. The spinach 5 S RNA has the nucleotide sequence identical with that of Chlorella in two important single-stranded regions, the sequence C10 AUACC and the dodecanucleotide sequence at positions 33 to 44. A nucleotide sequence similar or identical with C10 AUACC is found in most other eukaryotic 5 S RNAs, including the 5 S RNA from human KB cells. In addition, a single-stranded loop of 12 residues corresponding to positions 33 to 44 in the spinach 5 S RNA sequence may be a general feature of eukaryotic cytoplasmic 5 S RNAs, while prokaryotic 5 S RNAs have a 13-member loop for the corresponding residues. Several other important homologies in primary and secondary structure have also been observed in comparing spinach 5 S RNA to other 5 S RNAs.

Base Sequence↗

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.

Base Sequence↗

Ultraviolet light-induced transformation of human cells to anchorage-independent growth.

We have developed a system for ultraviolet light (UV) transformation of human embryonic cells to anchorage-independent growth. The procedure involves multiple UV irradiations, post irradiation growth, and plating in soft agar. Transformants are obtained at frequencies from 1 to 80 per 10(5) cells at UV exposures to 25 J/sq m. The resulting transformants can be subcultured on solid surfaces. The cells show crisscrossing and piling up; they reach 2- to 5-fold higher saturation densities than the parental cells. Some subcultures show increased plating efficiency in soft agar and increased life span. The susceptibility of the UV transformation process to apparent photoenzymatic reversal implies that purimidine dimers play a role in its induction.

Cell Adhesion↗

Accessibility of guanine at position 44 in the invariant sequence 5'CCG44AAC3' of Escherichia coli 5S RNA to reaction with kethoxal.

The reaction of Escherichia coli ribosomes with beta-ethoxy-alpha-ketobutyraldehyde (kethoxal) in a buffer containing 50--100 mM Tris.HCl at pH 7.4, 50 mM NH4Cl, and 5 mM Mg(OAc)2 readily released the 5S RNA from the ribosomes. When liberated, the 5S RNA is in a conformation such that position 44 is selectively reactive, in addition to the normally reactive quanines at positions 41 and 13. Positions 41 and 13 have been previously shown to react in the 5S RNA in situ. The resulting new RNase T1 resistant oligonucleotides 5'CCG 44K AAUCAG51(3') and 5'ACCCCAUG 41KCCG 44KAACUCAG51(3') have been isolated and identified. These oligonucleotides have not been found in RNase T1 digests of 5S RNA that is not released from the ribosome. The guanine at position 44 is part of the invariant sequence 5'CCG44AAC3' which includes that portion of the molecule thought to interact with the invariant 5'GT psi C3' of tRNAs in the ribosomal A site. This invariant sequence of the 5S RNA may also form part of the binding site for protein L5.

Aldehydes↗