PubMed Health⌕ Search

Biomedical subjects

N Lapsys

Publications and source records attributed to N Lapsys.

5 recordsLinked to original sources
PubMed2002

Calpain 3 gene expression in skeletal muscle is associated with body fat content and measures of insulin resistance.

OBJECTIVE: To investigate whether skeletal muscle gene expression of calpain 3 is related to obesity and insulin resistance. DESIGN: Cross-sectional studies in 27 non-diabetic human subjects and in Psammomys obesus, a polygenic animal model of obesity and type 2 diabetes. MEASUREMENTS: Expression of CAPN3 in skeletal muscle was measured using Taqman fluorogenic PCR. In the human subjects, body composition was assessed by DEXA and insulin sensitivity was measured by euglycemic-hyperinsulinemic clamp. In Psammomys obesus, body composition was determined by carcass analysis, and substrate oxidation rates, physical activity and energy expenditure were measured by whole-body indirect calorimetry. RESULTS: In human subjects, calpain 3 gene expression was negatively correlated with total (P = 0.022) and central abdominal fat mass (P = 0.034), and with blood glucose concentration in non-obese subjects (P = 0.017). In Psammomys obesus, calpain 3 gene expression was negatively correlated with circulating glucose (P = 0.013) and insulin (P = 0.034), and with body fat mass (P = 0.049). Indirect calorimetry revealed associations between calpain 3 gene expression and carbohydrate oxidation (P = 0.009) and energy expenditure (P = 0.013). CONCLUSION/INTERPRETATION: Lower levels of expression of calpain 3 in skeletal muscle were associated with reduced carbohydrate oxidation and elevated circulating glucose and insulin concentrations, and also with increased body fat and in particular abdominal fat. Therefore, reduced expression of calpain 3 in both humans and Psammomys obesus was associated with phenotypes related to obesity and insulin resistance.

Adipose Tissue↗
PubMed1998

Obesity: genes, glands or gluttony?

Distribution as well as amount of fat has health implications; central abdominal fat seems to be the major contributor to insulin resistance and risk of diabetes, hypertension and cardiovascular disease. Physical activity and diet affect overall adiposity; moreover, exercise specifically reduces visceral fat. The sexes differ in fat distribution; in particular, pre-menopausal women, despite greater overall adiposity, have much less visceral fat than men. There is a strong genetic determination of overall obesity and central abdominal adiposity. Genes regulating obesity (e.g. Ob) could modulate appetite, satiety, metabolic rate or physical activity. Moderate obesity probably results from interaction between genetic predisposition and an environment of abundant calories and reduced physical activity. Single gene mutations are being identified in a few morbidly obese people; however, the common genetic predisposition for obesity may relate to more subtle variations in regulatory controls. Diet and exercise are effective for some, but the response is often disappointing. Definition of pathways controlling appetite, metabolic rate and lipid metabolism may generate improved pharmacological compounds. Education and availability of lower-energy foods may help, but more radical approaches may be needed, such as environmental restructuring to increase physical activity. The problem is great, but failure will mean intolerably increased health costs.

Adipose Tissue↗
PubMed1997

Assignment of the Y4 receptor gene (PPYR1) to human chromosome 10q11.2 and mouse chromosome 14.

The human and mouse genes for the neuropeptide Y4 receptor have been isolated, sequenced, and shown to contain no introns within the coding region of the gene. Nonisotopic in situ hybridization and interspecific mouse backcross mapping have localized the genes to human chromosome 10q11.2 and mouse chromosome 14. Five nucleotide variants, which do not alter the protein sequence, have been identified within the coding region of the human receptor gene. The human Y4 subtype is most closely related to the Y1-receptor subtype (42%), suggesting that it evolved from an ancestral Y1-like receptor via an RNA-mediated transpositional event.

Animals↗
PubMed1997

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat.

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Base Composition↗