PubMed Health⌕ Search

Biomedical subjects

N Muzyczka

Publications and source records attributed to N Muzyczka.

At least 55 records · Page 3Linked to original sources
PubMed1996

Sequence requirements for binding of Rep68 to the adeno-associated virus terminal repeats.

We have used reciprocal competition binding experiments with mutant substrates and chemical modification interference assays to precisely define the sequences within the adeno-associated virus (AAV) terminal repeat (TR) that are involved in site-specific binding to the AAV Rep protein. Mutagenesis experiments were done with a 43-bp oligonucleotide which contained the Rep binding element (RBE) within the A stem of the TR. Experiments in which two adjacent base pairs of the RBE were substituted simultaneously with nucleotides that produced transversions identified a 22-bp sequence (CAGTGAGCGAGCGAGCGCGCAG) in which substitutions measurably affected the binding affinity. Although the 22-bp RBE contains the GAGC motifs that have been found in all known Rep binding sites, our results suggest that the GAGC motifs alone are not the only sequences specifically recognized by Rep. The effects of substitutions within the 22-bp sequence were relatively symmetrical, with nucleotides at the periphery of the RBE having the least effect on binding affinity and those in the middle having the greatest effect. Dinucleotide mutations within 18 (GTGAGCGAGCGAGC) of the 22 bp were found to decrease the binding affinity by at least threefold. Dinucleotide mutations within a 10-bp core sequence (GCGAGCGAGC) were found to decrease binding affinity by more than 10-fold. Single-base substitutions within the 10-bp core sequence lowered the binding affinity by variable amounts (up to fivefold). The results of the mutagenesis analysis suggested that the A-stem RBE contains only a single Rep binding site rather than two or more independent sites. To confirm the results of the mutant analysis and to determine the relative contribution of each base to binding, chemical modification experiments using dimethyl sulfate and hydrazine were performed on both the linear A-stem sequence and the entire AAV TR in both the flip and flop hairpinned configurations. Interference assays on the linear A stem identified the 18-bp sequence described above as essential for binding. G, C, and T residues on both strands contributed to binding, and the interference pattern correlated well with the results of the mutagenesis experiments. Interference assays with complete hairpinned TR substrates also identified the 18-bp sequence as important for binding. However, the interference patterns on the two strands within the RBE and the relative contributions of the individual bases to binding were clearly different between the hairpinned substrates and the linear A-stem binding element. Interference assays also allowed us to search for residues within the small internal palindromes of the TR (B and C) that contribute to binding. The largest effect was seen by modification of two T residues within the sequence CTTTG. This sequence was present in the same position relative to the terminal resolution site (trs) in both the flip and flop orientations of the TR. In addition, the interference pattern suggested that the remaining bases within the CTTTG motif as well as other bases within the B and C palindromes make contacts with the Rep protein, albeit with lower affinities. Regardless of whether the TR was in the flip or flop orientation, most of the contact points were clustered in the small internal palindrome furthest away from the trs. We also determined the relative binding affinity of linear substrates containing a complete RBE with hairpinned substrates and found that linear substrates bound Rep less efficiently. Our results were consistent with our previous model that there are three distinct elements within the hairpinned AAV TR that contribute to binding affinity or to efficient nicking at the trs: the A-stem RBE, the secondary structure element which consists of the B and C palindromes, and the trs.

Animals↗
PubMed1996

A "humanized" green fluorescent protein cDNA adapted for high-level expression in mammalian cells.

We constructed gfph, a synthetic version of the jellyfish Aequorea victoria green fluorescent protein (gfp) cDNA that is adapted for high-level expression in mammalian cells, especially those of human origin. A total of 92 base substitutions were made in 88 codons in order to change the codon usage within the gfp10 coding sequence so that it was more appropriate for expression in mammalian cells. We also describe a series of versatile recombinant adeno-associated virus and adenovirus vectors for delivery and expression of genes into mammalian cells and, using these vectors, demonstrate the efficient transduction and expression of the gfph gene in the human cell line 293 and also in vivo, within neurosensory cells of guinea pig eye. Cells infected with recombinant adeno-associated virus-GFPH can be readily sorted by fluorescence-activated cell sorting, suggesting that the newly designed gfph gene could be widely used as a reporter in many gene delivery technologies, including human gene therapy.

Amino Acid Sequence↗
PubMed1996

Development of in vivo gene therapy for hearing disorders: introduction of adeno-associated virus into the cochlea of the guinea pig.

Gene therapy is currently being used to treat many disorders including cancer, viral infection and the degenerative and fatal diseases of the cardiovascular and the central nervous systems. However, the potential use of gene therapy for alleviation of hearing impairment has not been investigated despite the absence of effective therapy for most forms of inherited hearing disorders. The purpose of this study was to assess the feasibility of introducing genetic material directly into the peripheral auditory system using adeno-associated virus (AAV) as the transfection vector and Hartley guinea pigs as the animal model. Approximately 10(5) particles of AAV containing the bacterial beta-galactosidase (beta-gal) sequence with Ad 2 major late promoter were infused into the cochlea of the animal with the aid of an osmotic minipump. Animals were killed after 2 weeks. Two Hartley guinea pigs with intracochlear saline infusion and four unoperated (nonperfused) animals served as negative controls. Both, the infused and the contralateral, non-infused cochleae were harvested from each animal, decalcified, and embedded in paraffin. Sections, 8 microns in width, were cut from the embedded cochleae and assayed for beta-gal expression via immunohistochemistry. Animals perfused with AAV showed intense immunohistochemical reactivity in the spiral limbus, spiral ligament, spiral ganglion cells and the organ of Corti in the perfused cochlea and a much weaker staining but with similar pattern in the contralateral ear. Cochleae from saline-infused and unoperated animals were devoid of the DAB stain. This study demonstrates for the first time in vivo expression of a foreign gene within the mammalian inner ear resulting from its localized, AAV-mediated introduction. The ability to introduce and stably express exogenous genetic material in the peripheral auditory system will have both experimental and therapeutic benefits. These results lay the groundwork for future studies assessing the potential use of gene therapy for alleviation of hearing impairment.

Animals↗
PubMed1995

Regulated high-level human beta-globin gene expression in erythroid cells following recombinant adeno-associated virus-mediated gene transfer.

Gene therapy approaches for beta-thalassemia and sickle cell anemia focus on the transfer of a human beta-globin gene into the patient's hematopoietic stem cells (HSC). Expression of the transferred sequences should be erythroid specific and match the expression of the endogenous alpha-globin genes in adult erythropoiesis. Here we explore the potential of recombinant adeno-associated virus (AAV) vectors for human beta-globin gene transfer. We have constructed a recombinant AAV-vector containing a human beta-globin gene together with the DNasel hypersensitive sites 4, 3 and 2 of the human beta-globin locus control region. The vector replicates to high titers and can efficiently transduce hematopoietic and non-hematopoietic cells. In transduced and G418 selected murine erythroleukemia (MEL) cell clones, human beta-globin gene expression was regulated and reached levels comparable to endogenous murine beta maj. These data show that AAV-vectors are promising tools in gene therapy approaches for the haemoglobinopathies.

Animals↗
PubMed1994

In vitro replication of adeno-associated virus DNA.

The study of eukaryotic viral DNA replication in vitro has led to the identification of cellular enzymes involved in DNA replication. Adeno-associated virus (AAV) is distinct from previously reported systems in that it is believed to replicate entirely by leading-strand DNA synthesis and requires coinfection with adenovirus to establish completely permissive replication. In previous work, we demonstrated that two of the AAV nonstructural proteins, Rep78 and -68, are site-specific endonucleases and DNA helicases that are capable of resolving covalently closed AAV termini, a key step in AAV DNA replication. We have now cloned the AAV nonstructural proteins Rep78, Rep68, and Rep52 in the baculovirus expression system. Using the baculovirus-expressed proteins, we have developed an efficient in vitro AAV DNA replication system which mimics the in vivo behavior of AAV in every respect. With no-end AAV DNA as the starting substrate, the reaction required an adenovirus-infected cell extract and the presence of either Rep78 or Rep68. Rep52, as expected, did not support DNA replication. A mutant in the AAV terminal resolution site (trs) was defective for DNA replication in the in vitro assay. Little, if any, product was formed in the absence of the adenovirus-infected HeLa cell extract. In general, uninfected HeLa extracts were less efficient in supporting AAV DNA replication than adenovirus-infected extracts. Thus, the requirement for adenovirus infection in vivo was partially duplicated in vitro. The reduced ability of uninfected HeLa extracts to support complete DNA replication was not due to a defect in terminal resolution but rather to a defect in the reinitiation reaction or in elongation. Rep78 produced a characteristic monomer-dimer pattern of replicative intermediates, but surprisingly, Rep68 produced little, if any, dimer replicative form. The reaction had a significant lag (30 min) before incorporation of 32P-deoxynucleoside triphosphate could be detected in DpnI-resistant monomer replicative form and was linear for at least 4 h after the lag. The rate of incorporation in the reaction was comparable to that in the simian virus 40 in vitro system. Replication of the complete AAV DNA molecule was demonstrated by the following criteria. (i) Most of the monomer and dimer product DNAs were completely resistant to digestion with DpnI. (ii) Virtually all of the starting substrate was converted to heavy-light or heavy-heavy product DNA in the presence of bromo-dUTP when examined on CsCl density gradients.(ABSTRACT TRUNCATED AT 400 WORDS)

Baculoviridae↗
PubMed1994

Identification of linear DNA sequences that specifically bind the adeno-associated virus Rep protein.

We have used baculovirus-expressed Rep68 that has been purified to homogeneity to reexamine the binding properties of the Rep protein. We find that Rep68 is capable of binding to a linear DNA sequence that is contained within a 25-bp sequence of the A stem of the adeno-associated virus (AAV) terminal repeat proximal to the B and C palindromes. This has been shown conclusively by demonstrating that Rep68 could specifically bind to a synthetic oligonucleotide containing the 25-bp region in the absence of the other sequences within the terminal repeat. Rep78 was also capable of binding the A stem recognition element, as demonstrated by the fact that a DNA affinity column containing the 25-bp sequence can be used to purify Rep78. The ability to recognize the linear DNA sequence within the A stem provides a mechanism by which the Rep protein can be oriented on the terminal repeat so that only the correct strand is cut at the terminal resolution site (trs site) during terminal resolution. In addition, computer analysis suggests that sequences similar to the A stem element are present within the three AAV promoter regions. Electrophoretic mobility shift experiments clearly demonstrate that the p5 promoter contains a Rep binding sequence. DNase protection experiments indicate that the Rep binding sequence within the p5 promoter is located between the YY1 initiator sequence and the TATA binding site. This position immediately suggests a mechanism by which the Rep protein could act as a repressor or a transactivator of p5 transcription by interacting with either YY1 or TBP. In addition, gel shift experiments suggest that the p19 promoter also contains a Rep binding site. The presence of Rep binding sites upstream of both promoters suggests that these sites may be involved in coordinate regulation of AAV transcription. In addition, we have identified a heterologous Rep binding sequence within pBR322 DNA. A comparison of the sequences within the A stem, p5, and pBR322 binding sites suggests that a repeating GAGC motif is at least part of the Rep recognition sequence. In the accompanying report (D. M. McCarty, J. H. Ryan, S. Zolutukhin, X. Zhou, and N. Muzyczka, J. Virol. 68:4998-5006, 1994), we examine the relative affinity of Rep to the A stem site and the complete terminal repeat. Finally, we also have reexamined the ability of Rep68 and Rep78 to cut at the trs site in substrates that do not contain the B and C palindromes or any apparent secondary structure.(ABSTRACT TRUNCATED AT 400 WORDS)

Animals↗
PubMed1994

Interaction of the adeno-associated virus Rep protein with a sequence within the A palindrome of the viral terminal repeat.

We have characterized a Rep binding sequence which is within the A stem region of the adeno-associated virus terminal repeat (TR) and compared its affinity with that of the complete hairpinned TR for pure Rep68. Both the A stem and the complete TR substrates produced a complex pattern of protein-DNA complexes in which at least six different bound species could be distinguished. Competition experiments suggested that the dissociation constant for the A stem sequence is approximately 125-fold higher than that for the complete TR. The competition experiments also suggested that the average number of Rep molecules per TR substrate molecule under conditions of saturating substrate is 3.7:1, while for the A stem substrate, the ratio is 10:1. In spite of the apparent difference in protein-to-DNA ratio in the complexes, no major difference was seen in the mobility or the pattern of the protein-DNA complexes with the two kinds of substrates, suggesting that the difference in protein-to-DNA ratio was due to the lower stability of the A stem complex rather than the actual number of Rep molecules per DNA molecule. At least some of the difference in stability of the two kinds of complexes was due to the fact that the dissociation rate of the A stem substrate from the protein-DNA complexes was approximately fourfold faster than that of the complete TR. The dissociation rate curves for both substrates, however, were complex, suggesting that substrate was being released from at least two different kinds of protein-DNA complexes at different rates. In addition, we have analyzed binding to several substitution mutants within the A stem of the TR. A five-base mutant near the terminal resolution site (trs site) had little effect on binding. Two other mutants produced seven- or five-base substitutions within the 25-bp sequence of the A stem that had been identified in the accompanying report (D. M. McCarty, D. J. Pereira, I. Zolotukhin, X. Zhou, J. H. Ryan, and N. Muzyczka, J. Virol. 68:4988-4997, 1994) as essential for binding. Each of these mutants eliminated some but not all of the repeating GAGC motifs in the 25-bp A stem region. Both of these mutants completely abolished binding to the A stem substrate but only partially reduced binding in the context of the complete hairpinned TR. Furthermore, neither mutant altered the pattern of Rep-DNA complexes produced.(ABSTRACT TRUNCATED AT 400 WORDS)

Animals↗
PubMed1993

Features of the adeno-associated virus origin involved in substrate recognition by the viral Rep protein.

We previously demonstrated that the adeno-associated virus (AAV) Rep68 and Rep78 proteins are able to nick the AAV origin of DNA replication at the terminal resolution site (trs) in an ATP-dependent manner. Using four types of modified or mutant substrates, we now have investigated the substrate requirements of Rep68 in the trs endonuclease reaction. In the first kind of substrate, portions of the hairpinned AAV terminal repeat were deleted. Only deletions that retained virtually all of the small internal palindromes of the AAV terminal repeat were active in the endonuclease reaction. This result confirmed previous genetic and biochemical evidence that the secondary structure of the terminal repeat was an important feature for substrate recognition. In the second type of substrate, the trs was moved eight bases further away from the end of the genome. The mutant was nicked at a 50-fold-lower frequency relative to a wild-type origin, and the nick occurred at the correct trs sequence despite its new position. This finding indicated that the endonuclease reaction required a specific sequence at the trs in addition to the correct secondary structure. It also suggested that the minimum trs recognition sequence extended three bases from the cut site in the 3' direction. The third type of substrate harbored mismatched base pairs at the trs. The mismatch substrates contained a wild-type sequence on the strand normally cut but an incorrect sequence on the complementary strand. All of the mismatch mutants were capable of being nicked in the presence of ATP. However, there was substantial variation in the level of activity, suggesting that the sequence on the opposite strand may also be recognized during nicking. Analysis of the mismatch mutants also suggested that a single-stranded trs was a viable substrate for the enzyme. This interpretation was confirmed by analysis of the fourth type of substrate tested, which contained a single-stranded trs. This substrate was also cleaved efficiently by the enzyme provided that the correct strand was present in the substrate. In addition, the single-stranded substrate no longer required ATP as a cofactor for nicking. Finally, all of the substrates with mutant trss bound the Rep protein as efficiently as the wild-type did. This finding indicated that the sequence at the cut site was not involved in recognition of the terminal repeat for specific binding by the enzyme. We concluded that substrate recognition by the AAV Rep protein involves at least two and possibly as many as four features of the AAV terminal repeat.(ABSTRACT TRUNCATED AT 400 WORDS)

Adenosine Triphosphate↗
PubMed1992

Partial purification of adeno-associated virus Rep78, Rep52, and Rep40 and their biochemical characterization.

We have used differential cell extraction and conventional chromatography to separate and partially purify the four adeno-associated virus (AAV) nonstructural proteins Rep78, Rep68, Rep52, and Rep40. In the cytoplasmic extracts Rep52 and Rep40 were present in greater abundance than Rep68 and Rep78, with Rep78 being the least abundant. In nuclear extracts the four Rep proteins were approximately equal in abundance. Regardless of the subcellular fraction examined, three of the Rep proteins (Rep78, Rep68, and Rep40) consisted of two protein species with slightly different mobilities during polyacrylamide gel electrophoresis. In contrast, Rep52 consisted of only one protein species. Both Rep78 and Rep68 were capable of binding efficiently to AAV terminal hairpin DNA substrates, but we could not detect site-specific DNA binding by Rep52 and Rep40. Like Rep68, Rep78 had both an ATP-dependent trs endonuclease and a DNA helicase activity. Both Rep78 and Rep68 cut the terminal AAV sequence at the same site (nucleotide 124). The binding, trs endonuclease, and DNA helicase activities comigrated during sucrose density gradient centrifugation with a mobility expected for a monomer of the protein, suggesting that the three biochemical activities were intrinsic properties of the larger Rep proteins. The chromatographic behavior and the DNA-binding properties of the four Rep proteins identified at least two domains within the rep coding region, an exposed hydrophobic domain within the C-terminal end (amino acids 578 to 621) and a region within the N terminus (amino acids 1 to 214) which was necessary for binding to the terminal repeat sequence. No site-specific nuclease activity was seen in the presence of nucleotide analogs ATP-gamma-S or AMP-PNP, suggesting that ATP hydrolysis was required for the endonuclease reaction. Furthermore, although ATP was the only cofactor which would support the trs endonuclease activity of Rep78, Rep68 nuclease activity was seen in the presence of several other nucleotide cofactors, including CTP, GTP, and UTP.

Binding Sites↗
PubMed1992

Analysis of mutations in adeno-associated virus Rep protein in vivo and in vitro.

The adeno-associated virus (AAV) Rep protein is required for both viral DNA replication and transactivation of the AAV promoters. Here we report the effects of mutations in the rep gene on transcription and replication in vivo and terminal repeat binding and terminal resolution site (trs) endonuclease activities in vitro. In all, we examined 10 in-frame deletions and 14 amino acid substitution mutations at eight positions. The point mutations were targeted to regions that are highly conserved among the parvovirus nonstructural proteins and include the extended ATPase domain of the AAV Rep protein. The mutations identify at least two noncontiguous regions of Rep which are essential for terminal repeat binding (amino acids 134 to 242 and amino acids 415 to 490). Mutations in either region render the protein inactive for both DNA replication and transactivation. In addition, mutations within a putative ATPase region also cause defects in replication and transactivation in vivo as well as in the ATP-dependent trs endonuclease activity in vitro. These results suggest that Rep transactivates via a novel mechanism which may require both DNA binding and an enzymatic activity, namely, ATPase or DNA helicase activity.

Base Sequence↗
PubMed1991

Sequences required for coordinate induction of adeno-associated virus p19 and p40 promoters by Rep protein.

A series of contiguous 30-bp deletions were introduced into the regions upstream of the p19 and p40 promoters of adeno-associated virus (AAV), and the effects of these deletions on induction of AAV transcription by the rep gene products was evaluated. A novel complementation system was devised for supplying wild-type Rep protein when mutations disrupted the trans activation activity of the Rep protein. Transcription from the p40 promoter was eliminated upon deletion of the TATA sequence located between -4 and -33 from the cap site. Deletions which removed sequences from -34 to -123 bp from the p40 mRNA start site substantially reduced Rep induction of p40 transcription. p19 transcription was also undetectable when the p19 TATA sequence between -4 and -33 was deleted. In contrast to the p40 region, two types of cis-active sequences were found associated with the p19 promoter. Sequences between -4 and -63 bp relative to the p19 cap site were essential for Rep induction only from the p19 promoter. Deletions between -94 and -153 bp relative to the p19 cap site reduced Rep induction of both the p19 and p40 promoters coordinately. These two noncontiguous regions were separated by a 30-bp sequence that was not essential for transcription control. Further deletion analysis delineated a second cis-active element, associated with the p5 promoter (AAV nucleotides 191 to 320), which was also necessary for coordinate Rep activation of both the p19 and p40 promoters. Finally, the dependence of p40 transcription on the Rep-responsive elements within the p5 and p19 regions could be overcome by the presence of the AAV terminal repeats, suggesting that the terminal repeats contained redundant Rep-responsive elements. These results implied an interdependence in cis between the three AAV promoters and suggested a novel mechanism for coordinate regulation of gene expression in response to the trans-activating Rep protein. Coordinate induction appeared to be the result of a simultaneous interaction between the Rep protein and sequence elements associated with two or all three of the AAV promoters.

Adenoviruses, Human↗
PubMed1990

Purification and characterization of HeLa endonuclease R. A G-specific mammalian endonuclease.

We previously reported a double-stranded endonuclease from HeLa cells, endonuclease R (endo R), which specifically cleaves duplex DNA at sites rich in G.C base pairs. In this report we describe the purification of endo R to near homogeneity by conventional and affinity chromatography. The molecular mass of the active form of endo R is approximately 115-125 kDa. SDS-gel electrophoresis reveals a major protein species of 100 kDa. The enzyme requires Mg2+ as a cofactor and is equally active on closed circular and linear duplex DNA substrates that contain G-rich sequences. A 50% reduction in cleavage activity is observed with Ca2+ ions and no double-stranded cleavage occurs with Zn2+. Use of Mn2+ causes an altered specificity at low concentrations of enzyme or divalent metal ion and nonspecific degradation of the substrate at higher concentrations. Endo R is strongly inhibited by sodium or potassium chloride and exhibits a wide pH optimum of 6.0-9.0. The pI of the enzyme is between 6.5 and 7.0. A 2-fold stimulation is observed with the addition of dGTP or dATP but specific cleavage is inhibited by ATP at an equivalent concentration. Cleavage activity is competitively inhibited 10-fold more efficiently by single-stranded poly(dG)12 than by other DNA competitors. The ends of endo R cleavage products contain 5'-phosphate and 3'-hydroxyl groups, and a significant portion of these products were substrates for T4 DNA ligase. Endo R appears to be a previously uncharacterized mammalian endonuclease.

Base Composition↗
PubMed1990

Substrate specificity of HeLa endonuclease R. A G-specific mammalian endonuclease.

We examined the substrate specificity of endonuclease R (endo R) a mammalian endonuclease that cleaves G.C-rich DNA sequences. The best substrates for double-stranded cleavage were homopolymeric stretches of poly(dG).poly(dC). Plasmids which contain other G-rich sequences were also cleaved but at a reduced frequency. These included the telomeric sequences, d(G4T2) and d(G2-6A), which were cleaved at approximately one-third the frequency of d(G)n.d(C)n. The alternating copolymer d(GA) and the terminal sequences of adeno-associated virus d(G1-3T/A) were also cut. Poly(dA).poly(dT) and the alternating copolymer d(GC)n were not detectably cleaved. Although endo R has a nicking activity which converts supercoiled plasmids to nicked circular DNA, the nicking activity is random with respect to plasmid sequences. Specific cleavage of G-rich sequences appears to occur by a concerted double-stranded mechanism. The cleavage pattern within the G-rich runs suggests that cleavage can occur anywhere within the G-rich region. Product ligation experiments indicate that a limited number of cleavage events (1-2) occur/molecule. Inasmuch as the best substrates for endo R are d(G)n.d(C)n and telomeric sequences, we suggest that endo R may directly recognize and cleave DNA that contains G.G base pairing.

Base Composition↗
PubMed1990

The AAV origin binding protein Rep68 is an ATP-dependent site-specific endonuclease with DNA helicase activity.

Genetic studies of adeno-associated virus (AAV) indicate that two AAV genes are required for viral DNA replication: the palindromic terminal repeat, which is the origin for DNA replication, and the rep gene, which codes for a family of at least four viral nonstructural proteins. To determine the biochemical function of the Rep proteins, we have purified the AAV Rep68 protein to apparent homogeneity. We find that it contains a site-specific and strand-specific endonuclease activity that specifically cuts the AAV origin at the terminal resolution site (TRS). The TRS endonuclease requires the presence of ATP for activity and becomes covalently attached to the 5' end at the cut site. In addition to the specific endonuclease activity, Rep68 also contains a DNA helicase activity. These results demonstrate that the large AAV Rep proteins have a direct role in AAV DNA replication; namely, they provide the activities required for the resolution of covalently joined AAV termini.

Adenosine Triphosphate↗
PubMed1990

In vitro resolution of covalently joined AAV chromosome ends.

We have developed an assay for a key step in the replication of adeno-associated virus (AAV) DNA. We demonstrate the covalently joined ends of linear AAV DNA can be resolved in vitro to the open duplex configuration. Only extracts prepared from human cells that have been infected with both adenovirus and AAV are capable of carrying out the reaction. The reaction is initiated by a site-specific and strand-specific endonucleolytic cut at a terminal resolution site near the end of the AAV terminal palindrome. During resolution the orientation of the terminal palindrome is inverted, and the 3' viral strand is extended by DNA synthesis. The size of the newly synthesized 3' strand is nearly identical to that found in viral particles. These observations provide direct biochemical evidence for an essential step in the model for AAV DNA replication.

Base Sequence↗
PubMed1990

Site-specific integration by adeno-associated virus.

Cellular sequences flanking integrated copies of the adeno-associated virus (AAV) genome were isolated from a latently infected clonal human cell line and used to probe genomic blots derived from an additional 21 independently derived clones of human cells latently infected with AAV. In genomic blots of uninfected human cell lines and of primary human tissue, each flanking-sequence probe hybridized to unique bands, but in 15 of the 22 latently infected clones the flanking sequences hybridized not only to the original fragments but also to a total of 36 additional species. AAV probes also hybridized to 22 of these new bands, representing 11 of the 15 positive clones, but never to the fragment characteristic of uninfected cell DNA. From these data we conclude that the AAV genome preferentially integrates into a specific region of the cellular genome. We have determined that the integration site is unique to chromosome 19 by somatic cell hybrid mapping, and this sequence has been isolated from uninfected human DNA.

Cell Line↗