PubMed Health⌕ Search

Biomedical subjects

N V Amirkhanov

Publications and source records attributed to N V Amirkhanov.

17 recordsLinked to original sources
PubMed2005

Synthesis of novel polydiamidopropanoate dendrimer PNA-peptide chimeras for non-invasive magnetic resonance imaging of cancer.

A variety of dendrimers can be conjugated to oligonucleotides to increase the number of contrast paramagnetic atoms (e.g., gadolinium or dysprosium) per probe. Thus, it was of interest to test a route for assembly of chelating dendrimer branches directly on the N-termini of peptide nucleic acid (PNA)-peptide chimeras by continuous solid-phase coupling on polymer supports. Dendrimer-PNA-peptides complementary to 12 nt of mutant KRAS mRNA have been prepared with a C-terminal insulin-like growth factor 1 (IGF1) analog d(Cys-Ser-Lys-Cys) and N-terminal polydiamidopropanoate (PDAP) dendrimers with different numbers of diaminopropanoate residues. 1,4, 7, 10-Tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA) chelating moieties were then coupled to PDAP dendrimer-PNA-peptide chimeras before cleavage from the polymer supports. The DOTA-PDAP-PNA-peptide probes with 1, 2, 4, 8, or 16 amino (or DOTA) moieties were cleaved, purified by RP-HPLC, and characterized by MALDI-TOF mass spectroscopy.

Base Sequence↗
PubMed2003

Cross-modulation of the pKa of nucleobases in a single-stranded hexameric-RNA due to tandem electrostatic nearest-neighbor interactions.

The pH titration studies (pH 6.7-12.1) in a series of dimeric, trimeric, tetrameric, pentameric, and hexameric oligo-RNA molecules [GpA (2a), GpC (3a), GpApC (5), GpA(1)pA(2)pC (6), GpA(1)pA(2)pA(3)pC (7), GpA(1)pA(2)pA(3)pA(4)pC (8)] have shown that the pK(a) of N(1)-H of 9-guaninyl could be measured not only from its own deltaH8G, but also from the aromatic marker protons of other constituent nucleobases. The relative chemical shift differences [Deltadelta((N)(-)(D))] between the protons in various nucleotide residues in the oligo-RNAs at the neutral (N) and deprotonated (D) states of the guanine moiety show that the generation of the 5'-(9-guanylate ion) in oligo-RNAs 2-8 reduces the stability of the stacked helical RNA conformation owing to the destabilizing anion(G(-))-pi/dipole(Im(delta)(-)) interaction. This destabilizing effect in the deprotonated RNA is, however, opposed by the electrostatically attractive atom-pisigma (major) as well as the anion(G(-))-pi/dipole(Py(delta)(+)) (minor) interactions. Our studies have demonstrated that the electrostatically repulsive anion(G(-))-pi/dipole(Im(delta)(-)) interaction propagates from the first to the third nucleobase quite strongly in the oligo-RNAs 6-8, causing destacking of the helix, and then its effect is gradually reduced, although it is clearly NMR detectable along the RNA chain. Thus, such specific generation of a charge at a single nucleobase moiety allows us to explore the relative strength of stacking within a single-stranded helix. The pK(a) of 5'-Gp residue from its own deltaH8G in the hexameric RNA 8 is found to be 9.76 +/- 0.01; it, however, varies from 9.65 +/- 0.01 to 10.5 +/- 0.07 along the RNA chain as measured from the other marker protons (H2, H8, H5, and H6) of 9-adeninyl and 1-cytosinyl residues. This nucleobase-dependent modulation of pK(a)s (DeltapK(a) +/- 0.9) of 9-guaninyl obtained from other nucleobases in the hexameric RNA 8 represents a difference of ca. 5.1 kJ mol(-)(1), which has been attributed to the variable strength of electrostatic interactions between the electron densities of the involved atoms in the offset stacked nucleobases as well as with that of the phosphates. The chemical implication of this variable pK(a) for guanin-9-yl deprotonation as obtained from all other marker protons of each nucleotide residue within a ssRNA molecule is that it enables us to experimentally understand the variation of the electronic microenvironment around each constituent nucleobase along the RNA chain in a stepwise manner with very high accuracy without having to make any assumption. This means that the pseudoaromaticity of neighboring 9-adeninyl and next-neighbor nucleobases within a polyanionic sugar-phosphate backbone of a ssRNA can vary from one case to another due to cross-modulation of an electronically coupled pi system by a neighboring nucleobase. This modulation may depend on the sequence context, spatial proximity of the negatively charged phosphates, as well as whether the offset stacking is ON or OFF. The net outcome of this electrostatic interaction between the neighbors is creation of new sequence-dependent hybrid nucleobases in an oligo- or polynucleotide whose properties are unlike the monomeric counterpart, which may have considerable biological implications.

Guanosine Monophosphate↗
PubMed2000

[Reactive derivatives of oligonucleotide phosphorothioate analogues. IV.Site-directed modification of nucleic acids in intramolecular alkylation of phosphorothioate groups].

Alkylation of the 22-mer DNA target pTGCCTGGAGCTGCTTGATGCCC (I) by oligodeoxynucleotide phosphorothioate derivatives (PTAO) GpsCpsApsTpsCpsApsApsGpsCpsApsGpsCpN(CH3)CH2(RCl) (II-PS) and (RCl)CH2N(CH3)pGpsCpsApsTpsCpsApsApsGpsCpsApsGpsC (III-PS) bearing a residue of an aromatic analogue of nitrogen lost (RCl = C6H4N(CH3)(CH2CH2Cl) at the 3'- or 5'-end was studied. It was shown that the internucleotide phosphorothioate bonds do not affect the regiospecificity of the target modification. The maximum degree of the target modification (at t-->infinity) at 20 degrees C was about 25% for both (II-PS) and (III-PS). The use of GCATCAAGCAGCpN(CH3)CH2(RCl) (II-PO), containing internucleotide phosphodiester bonds, under the same conditions gave about 65% of the modified DNA. Kinetics of the PTAO-induced complementarily addressed nucleic acid (NA) modification was analyzed. The rate constants of the reaction of the intermediate reactive ethylenimmonium ion with phosphorothioate groups of the reagents were evaluated both in solution and in duplex. The intramolecular alkylation of phosphorothioate groups considerably affected the DNA target modification by decreasing the effectiveness of the modification in a wide range of temperatures and changing the temperature dependence of the modification from a bell-like to an S-like profile. It was concluded that, in the course of the modification, the PTAO phosphorothioate groups are intramolecularly alkylated both in solution and in the complementary NA target-oligonucleotide duplex.

Alkylating Agents↗
PubMed1998

[Irregular temperature dependence of the efficiency of nucleic acids site-directed modification by oligonucleotide reagents producing reactive intermediates].

A 22-mer target DNA pTGCCTGGAGCTGCTTGATGCCC (I) was modified by a dodecadeoxyribonucleotide reagent GCATCAAGCAGCp[N(CH3)CH2RCl] (II) containing a 3'-terminal alkylating group (RCl = -C6H4N(CH3)(CH2CH2Cl). An anomalous, bell-shaped temperature dependence of the maximum extent of the modification was found. Based on the analysis of the kinetic scheme of the modification, a possible explanation for this experimental fact is given.

Alkylation↗
PubMed1997

[Reactive derivatives of phosphorothioate oligonucleotide analogues. II. Properties of phosphorothioate oligodeoxyribonucleotide derivatives containing an aromatic residue of nitrogen mustard gas].

The alkylating properties of the derivatives of phosphorothioate oligonucleotide analogues containing the alkylating 3'-[N-methyl-4-(N'-methyl-N'-2-chloroethylamino)benzyl]phosphamide group were studied using the alkylating 3'-phosphamide derivative of trithymidine phosphorothioate TpsTpsTpN(CH3)CH2RCl. It was shown by ion-exchange chromatography and 31P NMR spectroscopy that reagents of this type are able to alkylate, depending on the conditions, both their own internucleotide phosphorothioate residues and nucleophiles in the medium. In the absence of external nucleophiles in aqueous media, TpsTpsTpN(CH3)CH2RCl forms predominantly the products of intramolecular alkylation of ps-groups rather than the products of hydrolysis of the RCl-group. In the presence of a nucleophile (1 M aqueous ethylenediamine), the reagent alkylates mainly the aliphatic amino groups of the nucleophile. If the ethylenediamine concentration is reduced to 0.1 M, both processes take place, whereby the rate of reaction with EDA is twice as high as that of intramolecular alkylation. The rate constant of the limiting stage of alkylation (ionization of the C-Cl bond), k0, does not depend on the presence of the competitive nucleophile (ethylenediamine) and is 3.95 x 10(-4) s-1 at 37 degrees C.

Alkylating Agents↗
PubMed1995

[Reactive derivatives of oligonucleotide phosphorothioate analogs. I. Selective activation of terminal phosphates and preparation of phosphamide derivatives of oligonucleotide phosphorothioate analogs].

Selective activation of the terminal phosphates of oligonucleotide analogs containing internucleotide phosphorothioate groups was carried out using the triphenylphosphine-dipyridyldisulfide reducing-oxidizing pair. This formed the basis for a new method of synthesizing various derivatives of phosphorothioate oligonucleotide analogs. Using this method, zwitterionic 3'-phosphamide derivatives of di- and trinucleotide phosphorothioates TpsTp and TpsTpsTp containing the 4-dimethylaminopyridine or N-methylimidazole residues were synthesized. The derivatives reacted almost quantitatively with amines to form, within 5-10 min, the corresponding 3'-phosphamides without cleavage of the internucleotide phosphorothioate groups. Alkylating derivatives of phosphorothioates TpsTp(N(CH3)CH2RCl) and TpsTpsTp(N(CH3)CH2RCl) (RCl = -C6H4N(CH3)CH2CH2Cl) were also synthesized by the proposed method. The internucleotide phosphorothioate residues of the oligonucleotide analogs were stable during the synthesis in DMF. The activity of the alkylating RCl groups in the synthesized compounds was maintained at 85-90%.

Dimethoate↗
PubMed1990

[Reactivity of oligonucleotide derivatives, containing methylphosphonate groups. VI. Increase in the effectiveness of directed action of alkylating derivatives of oligonucleotide methylphosphonate analogs on nucleic acids in the presence of effectors--3',5'-bis-N-(2-hydroxyethyl)-phenazine derivatives of oligonucleotides].

Effectors for increasing the efficiency of DNA modification with the alkylating methylphosphonate analogues of oligodeoxyribonucleotides (MFAO) were suggested. Oligodeoxyribonucleotide d(pC5A8ACAATG) used as a target DNA treated with alkylating derivatives of octathymidylate having alternating methylphosphonate and phosphodiester internucleotide bonds (both Rp- and Sp-individual diastereoisomers of MFAO were used) and bearing alkylating 4-(N-methyl-N-2-chloroethylamino)benzyl phosphoramide residue at the 3'-end. The reactions were carried out in the presence of an effector, hexadeoxyribonucleotide derivative PhnNH(CH2)2NHpCATTGTpNH(CH2)2NHPhn bearing two N-(2-hydroxyethyl)phenazinium (Phn) residues at the 3'- and 5'-ends and being complementary to the part of the target DNA neighbouring with octaadenylate. It was shown that Tm of the duplex formed by the target DNA, octathymidylate and effector is by 7-13 degrees C higher than in the absence of the effector, thus considerably increasing the efficiency of the intracomplex alkylation of the target (e.g., at 40 degrees C, the increase for the reagent based on the Rp-isomer is sixfold). Specificity of the target DNA modification by the MFAO alkylating derivatives in the presence of effector is same as with reagents based on oligodeoxyribonucleotides with natural internucleotide bonds.

Alkylating Agents↗
PubMed1990

[Reactive oligonucleotide derivatives containing methylphosphonate groups. V. Increased effectiveness of complementary addressed modification of target DNA by alkylating derivatives of methylphosphonate analogs of octathymidylate containing N-(2-hydroxyethyl)phenazinium residues].

Efficiency of the intracomplex alkylation of octadecadeoxyribonucleotide d(pC5A8C5) (target) by Rp- and Sp-individual diastereomers of the methylphosphonate octathymidylate 4-(N-methyl-N-2-chloroethylamino)benzyl phosphoramide (-pNHCH2RCl) derivatives bearing an additional N-(2-hydroxyethyl)phenazinium residue (phn), viz. ClRCH2NHpTp.(TpTp)3TpNH(CH2)2NHPhn (I) and PhnNH(CH2)2NHpTp(TpTp)3TpNHCH2RCl (II) (p = -OP(O) (CH3)O-), has been investigated. Stabilisation of the complementary complex formed by the target oligonucleotide and methylphosphonate oligonucleotide derivatives by the Phn group considerably rose the efficiency of the intracomplex alkylation of the target as compared with alkylation by reagents without Phn. RP-isomeric derivatives of (I) and (II) proved to be the most effective alkylating reagents. Specificity of alkylation of nucleic acid target by reagents (I) and (II) is studied.

Alkylating Agents↗
PubMed1989

[Reactivity of oligonucleotide derivatives, containing a methylphosphate group. Affinity modification of target DNA by 4-N-(methyl-N-2-chlorethylamino)benzyl 3'- and 5'-phosphamide derivatives of octathymidylate containing methylphosphonate residues].

Modification of 5'-32P-labelled octadecadeoxyribonucleotide d(pC5A8C5) (III) with octathymidylate methylphosphonate derivatives bearing both 3'- and 5'-terminal alkylating 4-(N-2-chloroethyl-N-methylamino)benzylphosphoamide residue has been investigated. Yield in the modification depends on configuration of methylphosphonate fragment, in case of Rp-isomer it may amount to 90%. Specificity of alkylation of nucleic acide target (III) by reagents based on the oligonucleotide methylphosphonates is almost the same as by reagents based on the oligonucleotides having phosphodiester internucleotide bonds.

Affinity Labels↗
PubMed1985

[Cloning of single-stranded synthetic DNA].

The method for cloning a single-stranded synthetic DNA with the short complementary oligonucleotides, that form corresponding restriction sites, is proposed. The potency of the method is demonstrated by cloning a single-stranded polynucleotide A (93 nucleotide residues (n. r.] in plasmid vector pBR327. The polynucleotide A includes a leader structure of the human fibroblast interferon gene. Oligonucleotides (IV) (20 n. r.) and (VI) (16 n. r.) were taken as strengthening complements and to create the sticky ends for the restrictases HindIII and EcoRI. 72% of the obtained clones appeared to be hybrid. Four hybrid clones were analyzed, and three of them carried the desirable insertion. The primary structures of these insertions are confirmed by sequencing.

Base Sequence↗
PubMedDate not supplied

[Pharmacokinetics and stability in the blood in vivo of phosphodiester and modified oligonucleotide derivatives].

In vivo stability and distribution of deoxyribooligonucleotides and 3'-end modified oligodeoxyribooligonucleotides were studied in blood serum and cells. Substitution of two 3'-end internucleotide phosphodiester bonds increased the stability of modified oligonucleotides. Modified oligonucleotides were shown to be stable in blood serum for up to 24 hours. Leukocytes did not bind oligonucleotides significantly, whereas erythrocytes accumulate mono-, di-, three-, tetranucleotides appeared in the blood stream as degradation products of the parent oligonucleotide.

Animals↗
PubMedDate not supplied

[The interaction of alkylating derivatives of oligodeoxyribonucleotides and their methylphosphonate analogs with Mycoplasma cells].

Alkylating derivatives of decathymidylates and methylphosphonate analogs of oligodeoxyribonucleotides (MPAO) were studied for their interaction with cells of Acholeplasma laidlawii PG-8, Mycoplasma capricolum California Kid, M. pneumoniae FH and phytopathogenic strain (St. 118). It is shown that MPAO of octa- and hexadecathymidylates as well as decathymidylates 3'-terminal modified by phenazine and cholesterol groupings are sorbed by mycoplasma cells and can penetrate inside the cells. Efficiency of binding of alkylating derivatives and MPAO with mycoplasma cells depends on interaction time of reagents, their concentration in the reaction mixture and temperature.

Acholeplasma laidlawii↗
PubMedDate not supplied

[The effect of various substituents, joined through the 5'- and 3'-ends of the primer, initiating properties during the polymerization reaction, catalyzed by AMV-revertase].

We investigated the interaction of AMV reverse transcriptase and Klenow fragment with oligonucleotide derivatives carrying different 3'- or 5'-terminal reactive groups. It was shown that the attachment of phenazinium, ethidium, and daunomycin residues to the 5'-terminal phosphate stabilized the enzyme template primer complexes, while cholesterol and hemin residues generally decreased their stability. The increased stability in solution correlated to a certain extent with the increase in affinity of the modified primers to the enzyme template complex. Coupling of bulky R residues to the primers had a weak effect on the maximal rate of primer conversion, which is likely to be a result of the lack of strong contacts between the substituents and the enzyme, and steric obstacles hindering translocation of the primer enzyme complex. We analyzed the inhibitory effect of 23 oligonucleotide derivatives (both complementary and noncomplementary to the template) with modified 3'- and 5'-ends, and revealed several analogs inhibiting polymerization catalyzed by AMV reverse transcriptase by 70-100% at 0.1-1 microM concentrations of the reagents.

Avian Myeloblastosis Virus↗
PubMedDate not supplied

[The binding and absorption by mollicute cells of antisignature analogs of oligodeoxyribonucleotides].

Processes of absorption and uptake of phosphorothioate, phosphorodithioate and methylphosphonate analogs of oligodeoxynucleotides which are complementary to "signature" 16S rRNA sequences by cells of Acholeplasma laidlawii PG-8. Mycoplasma fermentans PG-18 and Mycoplasma pneumoniae FH have been investigated. Distinctions in efficiency of absorption by given cells of phosphorothioate and methylphosphonate analogs of oligonucleotides are found out. So, the level of thioates sorption by the cells of A. laidlawii PG-8 exceeded a share of methylphosphonates binding with these cells 5 times as high. A fact of significant accumulation of thio- and dithioate analogs of oligonucleotides by the mollicute cells is established. The intracellular concentration of these compounds in all investigated microorganisms exceeded extracellular one 10(4)-10(5) time. On the basis of obtained experimental data the assumption is made on existence in mollicute cells of two various mechanisms of uptake of analogs of oligonucleotides bearing a negative charge in sugar-phosphate backbone and nonionic oligonucleotide analogs.

Absorption↗