PubMed HealthSearch

Biomedical subjects

N V Fedoroff

Publications and source records attributed to N V Fedoroff.

16 recordsLinked to original sources

Mobility of the maize suppressor-mutator element in transgenic tobacco cells.

Maize Suppressor-mutator (Spm) transposable elements have been introduced into tobacco cells and a visual assay for Spm activity has been developed using a bacterial beta-glucuronidase gene. The Spm element is mobile in tobacco and can trans-activate excision of a transposition-defective Spm (dSpm) element either from a different site on the same transforming Ti plasmid or from a second plasmid. An Spm element expressed from the stronger cauliflower mosaic virus 35S promoter trans-activates transposition of a dSpm element earlier after its introduction into tobacco cells than an element expressed from its own promoter.

Base Sequence

Is the Suppressor-mutator element controlled by a basic developmental regulatory mechanism?

We report the results of genetic studies on derivatives of two different alleles of the maize a locus with an insertion of the Suppressor-mutator (Spm) transposable element in which the element is inactive, but can be reactivated readily. We present evidence that the mechanism that determines whether the element is in an active or inactive phase has two genetically distinguishable components. One determines whether or not the element is genetically active (the phase setting) and the other determines the stability of the setting in development, its heritability, and its phase in the next generation (the phase program). We show that the element's phase can be reset in a reproducible pattern during plant development. We also show that the Spm element can be reprogrammed to undergo a subsequent phase change without a concomitant phase change. The capacity to reset and reprogram the Spm element is differentially expressed within the plant in a pattern that is correlated with the developmental fate of apical and lateral meristems, suggesting the involvement of a basic developmental determination mechanism.

Alleles

Genetic and molecular analysis of the Spm-dependent a-m2 alleles of the maize a locus.

The Suppressor-mutator (Spm) transposable element family of maize consists of the fully functional standard Spm (Spm-s) and many mutant elements. Insertion of an Spm element in or near a gene can markedly alter its expression, in some cases bringing the gene under the control of the mechanisms that regulate expression of the element. To gain insight into such mechanisms, as well as to enlarge our understanding of the Spm element's genetic organization, we have analyzed derivatives of a unique Spm insertion at the maize a locus in which the gene is co-expressed and co-regulated with the element. We describe the genetic properties and the structure of the a locus and Spm element in 9 strains (collectively designated the a-m2 alleles) selected by McClintock from the original a-m2 allele for heritable changes affecting either the Spm element or expression of the a gene. Most of the mutations are intra-element deletions within the 8.3-kb Spm element; many alter both Spm function and expression of the gene. Spm controls a gene expression in alleles with internally deleted, transposition-defective Spm elements and element ends contain the target sequences that mediate Spm's ability to activate expression of the gene. We argue that the properties of the a-m2 alleles reflect the operation of an element-encoded positive regulatory mechanism, as well as a negative regulatory mechanism that affects expression of the element, but appears not to be mediated by an element-encoded gene product.

Alleles

Deletions within a defective suppressor-mutator element in maize affect the frequency and developmental timing of its excision from the bronze locus.

Six independent derivatives of the bz-m13 allele, which contains a 2.2-kilobase-pair defective Suppressor-mutator (dSpm) insertion at the bronze (bz) locus, have been isolated and analyzed. The derivatives were selected for alterations in the frequency and timing of somatic reversion; such derivatives have previously been analyzed genetically and designated "changes in state" by McClintock [McClintock, B. (1955) Carnegie Inst. Washington, Yearb. 54, 245-255]. All of the derivatives analyzed in the present study revert substantially later in development than the original insertion mutation and some show a very low frequency of reversion as well. All of the derivatives contain insertions at the same site as the parent bz-m13 allele. Deletions of 400-1300 base pairs were found in the dSpm elements in four of the six derivatives; the remaining derivatives could not be distinguished structurally from the original mutant allele. The results suggest that changes in the frequency and developmental timing of excision are attributable to alterations in the dSpm element. Furthermore, these data suggest that DNA sequences near the ends of the element are important for responding to the two transacting functions supplied by the transposition-competent Suppressor-mutator (Spm) element.

Base Sequence

Deletion mutants of Xenopus laevis 5S ribosomal DNA.

Deletion mutants have been derived from a plasmid-cloned repeating unit of Xenopus laevis oocyte 5S DNA by introducing the transposable chloramphenicol-resistance element Tn9 into the AT-rich spacer sequence near the 5' terminus of the X. laevis 5S rRNA gene in a recombinant plasmid and then selecting plasmids which had lost the transposable element. Plasmids lacking the entire transposable element and various portions of the AT-rich spacer sequence flanking the original site of Tn9 integration have been obtained, and their ability to support transcription of the remaining X. laevis 5S rRNA gene has been tested in X. laevis oocyte nuclei. The deletion mutants analyzed in the present study retain the 49 nucleotide nonrepetitive sequence immediately adjacent to the 5' terminus of the gene, but lack as much as 80% of the repetitive AT-rich spacer sequence (Fedoroff and Brown, 1978). Such deletion mutants are fully active templates for 5S rRNA synthesis. This implies that the AT-rich spacer, which comprises half or more of each repeating unit in X. laevis oocyte 5S DNA, is relatively unimportant for correct initiation of transcription, and that if there are extragenic sequences with promoter function, they are likely to reside in the short nonrepetitive region immediately adjacent to the gene.

Animals

On spacers.

Explore the source record for details and available documents.

Alleles

The nucleotide sequence of oocyte 5S DNA in Xenopus laevis. I. The AT-rich spacer.

The primary sequence of the principal spacer region in X. laevis oocyte 5S DNA has been determined. The spacer is AT-rich and comprises half or more of each repeating unit. The sequence is internally repetitious; most of it can be represented by the following set of oligonucleotides: CAACAGTTTTCAAAAGGTTTCGAAGTTTTT(T). The spacer, which varies in length from about 360 to 570 or more nucleotides, can be subdivided into a region (A2) which is variable in length in different repeating units, flanked by regions (A1, A3, B1) which are relatively constant in length. The A2 region consists, on the average, of 5-6 tandem copies of the oligonucleotide CAAAGTTTGAGTTTT; variation in the redundancy of this oligonucleotide accounts for much of the repeat length variation in the genomic 5S DNA. Most copies of this oligonucleotide are identical, although several differing by 1 or 2 nucleotides have been detected in plasmid-cloned 5S DNA fragments. Regions A1 and A3 comprise a linear array of similar, but not identical, oligonucleotides; most repeating units contain very similar A1 and A3 sequences. Region B1 is a sequence of 49 nucleotides immediately adjacent to the 5' terminus of the 5S rRNA sequence. It is GC-rich, much less repetitive than the remainder of the spacer and contains several palindromes, but no regions of dyad symmetry. This sequence is identical in all six of the single cloned repeating units of 5S DNA analyzed.

Adenine

The nucleotide sequence of oocyte 5S DNA in Xenopus laevis. II. The GC-rich region.

The primary sequence of the GC-rich half of the repeating unit in X. laevis 5S DNA has been determined in both a single plasmid-cloned repeating unit and in the total population of repeatig units. The GC-rich half of the repeating unit contains a single long duplication of 174 nucleotides. The duplicated segment commences 73 nucleotides preceding the 5' end of the gene and terminates at nucleotide 101 of the gene. The duplicated portion of the gene, termed the pseudogene, differs by 10 nucleotides from the corresponding portion of the gene, and the remaining duplicated sequence of 73 nucleotides differs by 13 nucleotides. The plasmid-cloned repeating unit differs from the dominant sequence in the total population repeating units by 6 nucleotides in the GC-rich region. Evidence is provided that most of the CpG dinucleotides in 5S DNA are at least partially methylated.

Animals

Structure of the poly(G) polymerase component of the bacteriophage f2 replicase.

A rifampicin-resistant poly(G) polymerase has been purified from f2 sus 11-infected cells. The poly(G) polymerase is believed to represent part of the f2 replicase on the basis of several criteria. It is present only in infected cells and shares the characteristic rifampicin resistance of crude f2 replicase activity. Partially purified poly(G) polymerase preparations exhibit replicase activity, synthesizing f2 "lus"strand RNA from denatured, partially double-stranded f2 RNA template. Highly purified poly(G) polymerase preparations, although lacking replicase activity, contain a protein which is electrophoretically identical to the protein product of the viral replicase cistron.

Carbon Isotopes