PubMed Health⌕ Search

Biomedical subjects

O F Borisova

Publications and source records attributed to O F Borisova.

At least 19 recordsLinked to original sources
PubMed1992

Evidence for the tetraplex structure of the d(GT)n repetitive sequences in solution.

The ability of oligonucleotides 3'-d(GT)5pO(CH2)6Opd(GT)5-5' (anti[d(GT)]) and 3'-d(GT)5pO(CH2)6Opd(GT)5-3' (par[par[d(GT)]) to form tertiary structures has been studied. Circular dichroism (CD) as well as the fluorescence of the ethidium bromide (EtBr) complexes with oligonucleotides and hydrodynamic volume measurements in solutions containing 0.01 M phosphate buffer, pH 7 and NaCl in concentrations from 0.1 M to 1 M, have been used. The data obtained in the temperature interval from 3 degrees C to 10 degrees C are in good agreement with the structure suggested earlier where the par[d(GT)] and anti[d(GT)] form structures with four parallel strands in which layers of four G-residues alternate with unpaired bulged-out T-residues. Ethidium bromide interacts with the structure in a cooperative manner. Two ethidium bromide molecules intercalate between two layers of four G-residues.

Base Sequence↗
PubMed1991

Spatial organization of template polynucleotides on the ribosome determined by fluorescence methods.

The spatial organization of template polynucleotides on the ribosome and the dynamics of their interaction with 30 S subunits have been studied by fluorescence spectroscopy. The topography of the mRNA in the ribosome has been determined using singlet-singlet energy transfer. This method has allowed us to estimate distances between donors and acceptors of energy which have been linked to the terminal residues of template polynucleotides (poly- and oligo(U) and oligo(A] and 16 S RNA or to SH-groups of ribosomal proteins S1 and S8. The dynamics of mRNA-ribosome interaction have been investigated by the fluorescence stopped-flow technique. It has been shown that the binding to the 30 S subunit of poly(U) with length much shorter (16 nucleotides) than that covered by the ribosome is greatly enhanced by protein S1. However, the final position of oligo(U)16 on the 30 S subunit, which probably includes the ribosomal decoding site, proves to be quite different from that occupied by oligo(U)16 on a free protein S1. Interaction of oligo- and poly(U) with the 30 S subunit occurs in at least two steps: the first one is as fast as the interaction of poly(U) with free S1, whereas the second step represents a first-order reaction. Therefore, the second step may reflect some rearrangement of the template in the ribosome after its primary binding. It is suggested that protein S1 in some cases may fulfill the role of a transient binding site for mRNA in the course of its interaction with the ribosome. The general shape of the template in the mRNA binding region of the ribosome has been studied using various synthetic ribopolynucleotides and has been shown to be similar. It can be represented by a loop(s) or "U-turn(s)". On the basis of estimation of distances from the ends of poly(U) to some well-localized points on the 30 S ribosomal surface, a tentative model of mRNA path through the ribosome is proposed.

Bacterial Proteins↗
PubMed1991

Parallel double stranded helices and the tertiary structure of nucleic acids.

Thermal denaturation of four oligonucleotides, viz. 3'-d(AT)5pO(CH2)6Opd(AT)5-3'(par(AT], 3'-d(AT)5pO(CH2)6Opd(AT)5-5'(anti(AT],3'-d(A)10pO(CH2) 6Op(T)10-3'(par(A-T], and 3'-d(A)10pO(CH2)6Opd(T)10-5' (anti(A-T], was studied in 0.01 M phosphate buffer, pH 7, in the presence of 0.1, 0.25, 0.5 and 1.0 M NaCl. All the oligomers were found to exist at a lower temperature (0 to 20 degrees C) as complexes composed either of two oligomer molecules (a canonical duplex) or of more oligomer molecules whereas, at a higher temperature (30 to 70 degrees C), they formed hairpins with a parallel (par(AT) and par(A-T] or antiparallel (anti(AT) and anti(A-T) orientation of the chains. Melting curves (A260(T] were used to calculate thermodynamic parameters for the formation of hairpins and "low-temperature" duplexes. Experiments on ethidium bromide binding to the oligonucleotides have shown that the oligomer anti(A-T) exists, at a low ionic strength, as a four stranded complex ("quadruplex") contains two antiparallel helices, d(A).d(T), which have a parallel orientation and are bound to one another owing to the formation of additional hydrogen bonds between nucleic acid bases. The possible biological function of quadruplexes is discussed.

Base Sequence↗
PubMed1990

Four-stranded DNA helices: conformational analysis of regular poly(dT).poly(dA).poly(dA).poly(dT) helices with various types of base binding.

The paper presents results obtained in conformational analysis of homopolymeric four-stranded poly(dT).poly(dA).poly(dA).poly(dT) DNA helices in which the pairs of strands with identical bases are parallel and have a two-fold symmetry axis. All possible models of base binding to yield a symmetric complex have been considered. The dihedral angles of sugar-phosphate backbones and helix parameters, which are consistent with the minima of conformational energy for four-stranded DNAs, have been determined using the results of optimization of conformational energy calculated at atom-atom approximation. Potential energy is shown to depend on the structure of base complexes and on the mutual orientation of unlike strands. Possible biological functions of four-stranded helices are discussed.

Base Composition↗
PubMedDate not supplied

[Secondary structure of nuclear precursors of the informational RNA (pre-mRNA)].

The secondary structure of pre-mRNA species from mouse Ehrlich ascites carcinoma cells extracted with phenol at the temperatures either 55-65 degrees C or 65-85 degrees C was investigated. A fraction of the double helical regions of pre-mRNA was estimated by two methods: a) by recording of melting curves; b) by measuring fluorescence lifetimes of acridine orange dye adsorbed on the nucleic acid. This fraction was about 64-68%. Further lowering of ionic strength down to 0.024 results in 10-15% decrease in the fraction of double regions. Both lowering of ionic strength and increase of the temperature up to 50-55 degrees C results in despiralisation of pre-mRNA regions which contain more than 70% of AU-nucleotide pairs. Only regions containing mainly GC-nucleotide pairs remain double-stranded under heating to temperatures above 50 degrees C. These facts were established on the basis of studies of acriflavin dye complexes with pre-mRNA.

Animals↗
PubMedDate not supplied

[Structure of d(GT)n repeating sequences with parallel and antiparallel chains].

The ability of oligonucleotides 3'-d(GT)5pO(CH2)5Opd(GT)5-5' (anti[d(GT)]) and 3'-d(GT)5pO(CH2)6Opd(GT)5-3' (par[d(GT)]) to form hairpins and higher associates is studied. Optical methods of thermal denaturation and circular dichroism as well as the fluorescence of ethidium bromide and acridine orange bound to oligonucleotides were used. At room temperatures the formation of hairpin structure with parallel and antiparallel strands is possible. Thermodynamic parameters of par[d(GT)] and anti[d(GT)] are similar and equal to delta H = -15 kcal/mol, delta S = -50 cal/mol. deg. In the temperature range 3-10 degrees C par[d(GT)] and anti[d(GT)] form four-stranded structures with parallel chains, in which layers of four G-residues alternate with unpaired T-residues being bulged out easily. On comparison of occurrence of alternating (GT)n, (GC)n and (G)n sequences in genome it can be stated that (GT)n biological functions could be connected with conformational possibilities of the four-stranded parallel structures with unpaired T-residues.

Circular Dichroism↗
PubMedDate not supplied

[A triple-stranded "clip" from the oligonucleotide 3'-(dA)10-pO(Ch2Ch2O)3p-(dT)10-pO(CH2CH2O)3-p-(dT)10(-5)].

The temperature dependence of the UV- and CD-spectra of the oligonucleotides 3'-d(A)10-L-(T)10-5' [anti(AT)], 3'-d(A)10-L-d(T)10-3' [par(AT)] and 3'-d(A)10-L-(dT)10-L-(dT)10-5' [tripl(ATT)] (L = -PO(CH2CH2O) 3p-) in the phosphate buffer at pH 7 under different concentrations of NaCL and in the presence or absence of 0.01 M MgCl2 was studied. All registered structural changes are the result of intramolecular processes if the concentrations of the oligonucleotides is low (about 2.2.10(-5) M). Par(AT) and anti(AT) exist in the only two forms, transforming into each other: under low temperatures they exist as hairpins with the parallel or antiparallel orientation of chains accordingly which transform into unfolded chains when the temperature increased. In contrast trip(ATT) exists in the three different forms depending on the temperature and ion conditions. They are: the three- stranded clip, the two-stranded hairpin with a single stranded "tail" and completely unfolded chain. For the first time this work presents thermodynamic parameters of the triplex formation from deoxyoligonucleotides depending on NaCl concentration. We have registered the CD spectra to one-, two-, and three-stranded forms. Ethidium bromide binding to three-stranded "clip" was investigated, and it was established that molecules of the dye may intercalate into the "clip" with formation of stable complexes (the constant of association 10(6) M-1). It is maximum three molecules of ethidium bromid which may bound to one molecule of the three-stranded clip. It has been shown that the suggested synthetic model (three oligonucleotide blocks combined by hydroxyalkyl chains) is the most convenient for physico-chemical investigations of triplexes today.

Base Sequence↗
PubMedDate not supplied

[Conformational transition of parallel DNA in solutions with decreased water activity].

Conformations of parallel deoxyoligonucleotides 5'd(CTATAGGGAT)3'/5'd(GATATCCCTA)3' and 5'd(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)3'/'5'd (ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)3' were studied in solution by CD method. A cooperative change in the CD spectra is observed in trifluoroethanol (TFE) solutions at decreased water activity (relative humidity). This distinctive change is supposed to stem from a cooperative conformational transition of parallel double helix from a B-like form with C2'endo sugar conformation to a A-like form designated as Ap. The free energy difference between Ap- and B-like conformations of the parallel decaduplex is close to that for antiparallel decaduplex with the nucleotide sequence studied. A-phility of a parallel helix is dependent on its sequence.

Base Sequence↗
PubMedDate not supplied

[Four-stranded DNA. Conformational analysis of regular spirals of poly(dT).poly(dA).poly(dA).poly(dT) with different base binding variations].

Conformational analysis of four stranded DNA helices poly(dT).poly(dA).poly(dA).poly(dT) with parallel arrangement of the identical sugar-phosphate chains connected by twofold symmetry has been performed. All possible models of symmetrical base binding were checked. By the potential energy optimization the dihedral angles and helices parameters of stable conformations of four stranded polynucleotides were calculated. The dependences of conformational energy on the base complex structure and mutual orientation of the poly(dA).and poly(dT) chains were studied. Possible biological functions of four stranded helices are discussed.

Base Sequence↗
PubMedDate not supplied

[Comparison of the conformation of RNA from phage MS2 and 16S rRNA. Accessibility to nucleases S1 and SV specific to secondary structure and thermal stability].

The hydrolysis of E. coli 16S rRNA by nucleases specific to the secondary structure elements (S1 and SV), the melting of the RNA after partial hydrolysis by nuclease S1 and the electrophoretic mobility of hydrolysis products after denaturation-renaturation of RNA were studied. It was shown that the sensitivity of 16S rRNA to nuclease S1 depends on Zn or Mg ions concentration. The melting curves after partial hydrolysis by nuclease S1 were characterized by a decrease of the hyperchromic effect (by approximately 15%) and by a increase of Tm (by 3 degrees). After RNA denaturation followed by slow or fast renaturation the electrophoretic patterns of the hydrolysis products were not changed, as in the case of phage MS2 RNA. It was supposed, that the rRNA molecule has a stable "nucleus" (or "nuclei"), which is organized as an intramolecular association of parallelly oriented double-stranded fragments of this RNA. Previously, such a mode of the spatial organization was proposed by us for phage MS2 RNA.

Coliphages↗