PubMed Health⌕ Search

Biomedical subjects

O Jardetzky

Publications and source records attributed to O Jardetzky.

At least 19 recordsLinked to original sources
PubMed1992

Computing the geometry of a molecule in dihedral angle space using n.m.r.-derived constraints. A new algorithm based on optimal filtering.

We have developed a method based on optimal filtering to determine the three-dimensional structure of a protein from n.m.r.-derived constraints, using the dihedral angle internal representation of the molecule. It differs from currently proposed methods in that it directly produces estimates of errors on the parameters that are refined, hence providing an image of the minimum that has been found. A similar algorithm had already been proposed using cartesian co-ordinates as independent parameters, encoded in PROTEAN2. We found that using dihedral angles significantly reduces the computational burden of the technique, and provides better control over a priori informations that can be used, such as geometric restrictions for proline residues and informations from vicinal coupling constants. Performance of the method, encoded in FILMAN, is demonstrated by application to the folding of a ten-residue alanine polypeptide, to the geometric cyclization of an 11-residue peptide, as well as on the folding of a medium size protein, i.e. tendamistat. The validity of the error estimates on the dihedral angles produced by FILMAN is discussed.

Algorithms↗
PubMed1992

A systematic comparison of three structure determination methods from NMR data: dependence upon quality and quantity of data.

We have systematically examined how the quality of NMR protein structures depends on (1) the number of NOE distance constraints, (2) their assumed precision, (3) the method of structure calculation and (4) the size of the protein. The test sets of distance constraints have been derived from the crystal structures of crambin (5 kDa) and staphylococcal nuclease (17 kDa). Three methods of structure calculation have been compared: Distance Geometry (DGEOM), Restrained Molecular Dynamics (XPLOR) and the Double Iterated Kalman Filter (DIKF). All three methods can reproduce the general features of the starting structure under all conditions tested. In many instances the apparent precision of the calculated structure (as measured by the RMS dispersion from the average) is greater than its accuracy (as measured by the RMS deviation of the average structure from the starting crystal structure). The global RMS deviations from the reference structures decrease exponentially as the number of constraints is increased, and after using about 30% of all potential constraints, the errors asymptotically approach a limiting value. Increasing the assumed precision of the constraints has the same qualitative effect as increasing the number of constraints. For comparable numbers of constraints/residue, the precision of the calculated structure is less for the larger than for the smaller protein, regardless of the method of calculation. The accuracy of the average structure calculated by Restrained Molecular Dynamics is greater than that of structures obtained by purely geometric methods (DGEOM and DIKF).

Magnetic Resonance Spectroscopy↗
PubMed1992

The effect of selective deuteration on magnetization transfer in larger proteins.

The effects of selective deuteration on calculated NOESY intensities have been analyzed for the structure of the E. coli trp aporepressor, a 25 kDa protein. It is shown that selectively deuterated trp aporepressor proteins display larger calculated NOESY intensities than those for the same interproton distances in the natural abundance protein. The relatively larger magnetization transfer is demonstrated by a comparison of the NOE build-up curves for specific proton pairs, and for the calculated NOE intensities of short-range NOEs to backbone amide protons. This increase in intensity is especially pronounced for the NHi-NHi+1 cross peaks in the alpha-helical regions, and particularly for amide protons of two sequential deuterated residues. The effect is shown to be further intensified for longer mixing times. It is also shown that in all cases, each amide proton exhibits stronger NOEs to its own side chain, with an enhanced effect for deuterated derivatives. This theoretical analysis demonstrates that an evaluation of the relative NOE intensities for different selectively deuterated analogs may be an important tool in assigning NMR spectra of large proteins. These results also serve as a guide for the interpretation of NOEs in terms of distances for structure calculations based on data using selectively deuterated proteins.

Amino Acid Sequence↗
PubMed1991

The solution structures of Escherichia coli trp repressor and trp aporepressor at an intermediate resolution.

We have determined the solution structures and examined the dynamics of the Escherichia coli trp repressor (a 25-kDa dimer), with and without the co-repressor L-tryptophan, from NMR data. This is the largest protein structure thus far determined by NMR. To obtain a set of data sufficient for a structure determination it was essential to resort to isotopic spectral editing. Line broadening observed in this molecular mass range precludes for the most part the measurement of coupling constants and stereospecific assignments, with the inevitable result that the attainable resolution of the final structure will be somewhat lower than the resolution reported for smaller proteins and peptides. Nevertheless the general topology of the protein can be deduced from the subsets of NOEs defining the secondary and tertiary structure, providing a basis for further refinement using the full set of NOEs and energy minimization. We report here (a) an intermediate resolution structure that can be deduced from NMR data, covalent, angular and van-der-Waals constraints only, without resort to detailed energy calculations, and (b) the limits of uncertainty within which this structure is valid. An examination of these structures combined with backbone amide exchange data shows that even at this resolution three important conclusions can be drawn: (a) the protein structure changes upon binding tryptophan; (b) the putative DNA binding region is much more flexible than the core of the molecule, with backbone amide proton exchange rates 1000 times faster than in the core; (c) the binding of tryptophan stabilizes the repressor molecule, which is reflected in both the appearance of additional NOEs, and in the slowing of backbone proton exchange rates by factors of 3-10. Sequence-specific 1H-NMR assignments and the secondary structure of the holopressor (L-tryptophan-bound form) have been reported previously [C. H. Arrowsmith, R. Pachter, R. B. Altman, S. B. Iyer & O. Jardetzky (1990) Biochemistry 29, 6332-6341]. Those for the trp aporepressor (L-tryptophan-free form), made using the same methods and conditions as described in the cited paper, are reported here. The secondary structure of the aporepressor was calculated from sequential and medium-range NOEs and is the same as reported for the holorepressor except that helix E is shorter. The tertiary solution structures for both forms of the repressor were calculated from long-range NOE data.(ABSTRACT TRUNCATED AT 400 WORDS)

Amino Acid Sequence↗
PubMed1991

. . . and at NIH.

Explore the source record for details and available documents.

Financing, Government↗
PubMed1991

A study of nephrotoxin-induced acute tubular necrosis with 31P magnetic resonance spectroscopy.

Phosphorus magnetic resonance spectroscopy (31P MRS) was used to obtain in vivo spectra from rat kidneys undergoing acute tubular necrosis induced by a nephrotoxic dose of cephaloridine (CLD). Spectra were obtained 0, 24, and 48 h after injection of CLD (experimental group, n = 6) or saline vehicle (control group, n = 6). The nephrotoxicity of CLD was demonstrated by severely increased serum creatinine levels and the development of extensive proximal tubular necrosis in the CLD-injected rats, and the lack of such changes in the controls. 31P MRS showed an increase in the inorganic phosphate region signal (Pi, p = 0.004) and a decrease in the phosphodiester region signal (PDE, p = 0.01) in the experimental group by 48 h, whereas these parameters did not vary significantly in the control group during the experiment. Significant correlations were found between serum creatinine and the same two 31P MRS parameters. In summary, rat kidneys which have developed severe CLD-induced proximal tubular necrosis exhibit changes in the 31P spectrum 48 h after administration of the drug. The causes of these changes were not determined.

Animals↗
PubMed1991

Segmental differences in the stability of the trp-repressor peptide backbone.

Exchange lifetimes of amide protons in trp-repressor with and without the corepressor, L-tryptophan, were studied by heteronuclear 2D NMR spectroscopy. The amide proton exchange times revealed pronounced differences in the stability of different regions of the trp-repressor. The dimeric core of the molecule is relatively compact and homogeneous in terms of the measured parameters in both apo- and holorepressors. On the other hand the DNA-binding region appears less stable and more susceptible to the exchange of its backbone protons with the solvent. The NMR findings reported here are consistent with and amplify information on the stability of the trp-repressor obtained by other methods.

Amino Acid Sequence↗
PubMed1990

Determination of metabolite and nucleotide concentrations in proliferating lymphocytes by 1H-NMR of acid extracts.

Nuclear magnetic resonance (NMR) studies of extracts have proven to be a powerful window onto the intracellular machinery of cells and tissues. The major advantages of in vitro 1H-NMR, namely chemical preservation, simultaneous detection, identification, and quantitation of compounds, and sensitivity to a large variety of classes of compounds, are employed in this study to characterize the metabolic course of mitogen-stimulated proliferation of human peripheral lymphocytes. A reliable method to quantitate amino acids, metabolic intermediates, soluble membrane lipid precursors, and purine, pyridine and pyrimidine nucleotides is presented, using samples as small as 30 mg wet weight. A total of 53 substances were detected in lymphocytes and other blood cells. During the course of lymphocyte culture, changes in intracellular concentrations of lactate, taurine, inositol and nucleotides, including NAD, IMP and high-energy phosphates, were especially marked. 1H-NMR compares favorably to 31P-NMR and to HPLC, and is especially attractive in light of expectations for future in vivo application.

Amino Acids↗
PubMed1990

Characterization of lipid composition in stimulated human lymphocytes by 1H-NMR.

Recent in vivo NMR studies have raised interest in the structural changes of cellular lipids during proliferative activity. We investigated the changes in plasma membrane lipid and total cell lipid during mitogenically-stimulated proliferation of human peripheral blood lymphocytes by extraction of lipids and assay by 500 MHz 1H-NMR. Resonances were assigned using one- and two-dimensional spectroscopic techniques, and signals unique to certain species of lipid were identified. Choline and ethanolamine-containing lipids, glycerophospholipid backbones, sphingolipids, cholesterol, plasmalogens and triacylglycerols were readily detected. Resolution of a number of lipid species was not possible, despite the use of high-resolution techniques. NMR values for proliferation-induced changes in the most easily determined parameters, namely the total cholesterol to total phospholipid molar ratio, and phosphatidylcholine, phosphatidylethanolamine and sphingolipid composition, were found to agree with traditional methods. Differences in phospholipid and fatty acid profiles were found between plasma membranes and total cell lipid for resting values and for response to mitogen.

Cell Membrane↗
PubMed1990

Sequence-specific 1H NMR assignments and secondary structure in solution of Escherichia coli trp repressor.

Sequence-specific 1H NMR assignments are reported for the active L-tryptophan-bound form of Escherichia coli trp repressor. The repressor is a symmetric dimer of 107 residues per monomer; thus at 25 kDa, this is the largest protein for which such detailed sequence-specific assignments have been made. At this molecular mass the broad line widths of the NMR resonances preclude the use of assignment methods based on 1H-1H scalar coupling. Our assignment strategy centers on two-dimensional nuclear Overhauser spectroscopy (NOESY) of a series of selectively deuterated repressor analogues. A new methodology was developed for analysis of the spectra on the basis of the effects of selective deuteration on cross-peak intensities in the NOESY spectra. A total of 90% of the backbone amide protons have been assigned, and 70% of the alpha and side-chain proton resonances are assigned. The local secondary structure was calculated from sequential and medium-range backbone NOEs with the double-iterated Kalman filter method [Altman, R. B., & Jardetzky, O. (1989) Methods Enzymol. 177, 218-246]. The secondary structure agrees with that of the crystal structure [Schevitz, R., Otwinowski, Z., Joachimiak, A., Lawson, C. L., & Sigler, P. B. (1985) Nature 317, 782], except that the solution state is somewhat more disordered in the DNA binding region and in the N-terminal region of the first alpha-helix. Since the repressor is a symmetric dimer, long-range intersubunit NOEs were distinguished from intrasubunit interactions by formation of heterodimers between two appropriate selectively deuterated proteins and comparison of the resulting NOESY spectrum with that of each selectively deuterated homodimer. Thus, from spectra of three heterodimers, long-range NOEs between eight pairs of residues were identified as intersubunit NOEs, and two additional long-range intrasubunits NOEs were assigned.

Amino Acid Sequence↗
PubMed1990

Inhibition of lymphocyte stimulation by shift reagents.

Lanthanide shift reagents have opened a new avenue in the study of membrane biochemistry, but their stabilities and biological reactivities remain questionable. We present evidence that shift reagents are not biologically inert, and that they exhibit the ability to inhibit stimulation of human peripheral lymphocytes at commonly used concentrations. A survey of various mitogens yielded no shift reagent-resistant modes of stimulation, and a survey of various shift reagents yielded no effective and nontoxic alternatives. Involvement of calcium-regulating mechanisms was not apparent. The assumption that lanthanide shift reagents used in NMR studies are nondestructive and physiologically innocuous is thus shown to be unwarranted.

Chelating Agents↗
PubMed1989

NMR studies of the Escherichia coli trp aporepressor. Sequence-specific assignment of the aromatic proton resonances.

The resonances in the aromatic region of the 1H-NMR spectrum of the Escherichia coli trp aporepressor have been assigned to amino acid type by two-dimensional correlated spectroscopy (COSY), homonuclear Hartmann-Hahn (HOHAHA) spectroscopy and nuclear Overhauser enhancement spectroscopy (NOESY) techniques and studies of the pH dependence of the chemical shifts, in combination with selective deuteration of the protein. Complete sequence-specific assignments of the aromatic resonances have been made by comparing the observed inter-residue NOEs with those expected on the basis of the crystal structure of the protein [Zhang, R.-G., Joachimiak, A., Lawson, C.L., Shevitz, R.W., Otwinowski, Z. & Sigler, P.B. (1987) Nature 327, 591-597]. The latter experiments have also permitted the sequence-specific assignment of some of the high-field methyl resonances. The complete assignment of the aromatic region of the spectrum, in particular of resonances from residues at the dimer interface, opens the way to detailed studies of the conformational effects of corepressor and operator binding.

Amino Acid Sequence↗
PubMed1989

NMR assignments for the amino-terminal residues of trp repressor and their role in DNA binding.

The trp repressor of Escherichia coli specifically binds to operator DNAs in three operons involved in tryptophan metabolism. The NMR spectra of repressor and a chymotryptic fragment lacking the six amino-terminal residues are compared. Two-dimensional J-correlated spectra of the two forms of the protein are superimposable except for cross-peaks that are associated with the N-terminal region. The chemical shifts and relaxation behavior of the N-terminal resonances suggest mobile "arms". Spin-echo experiments on a ternary complex of repressor with L-tryptophan and operator DNA indicate that the termini are also disordered in the complex, although removal of the arms reduces the DNA binding energy. Relaxation measurements on the armless protein show increased mobility for several residues, probably due to helix fraying in the newly exposed N-terminal region. DNA binding by the armless protein does not reduce the mobility of these residues. Thus, it appears that the arms serve to stabilize the N-terminal helix but that this structural role does not explain their contribution to the DNA binding energy. These results suggest that the promiscuous DNA binding by the arms seen in the X-ray crystal structure is found in solution as well.

Bacterial Proteins↗
PubMed1989

1H NMR spectroscopy: an approach to evaluation of diseased skin in vivo.

1H nuclear magnetic resonance (NMR) spectroscopy was tested for its applicability in evaluating diseased skin. In order to explore potential spectral markers characteristic of diseased tissue, perchloric acid (PCA) extracts of psoriasis and malignant melanoma tissues were compared with normal skin, and changes in melanoma after heat treatment were monitored. In psoriatic plaque extract, the spectral peak intensity ratios of Glu: Ser, creatine: Gly, and taurine: Ala were approximately three-fold compared with symptom-free or normal skin, whereas Val: Leu/Ile was one-half the normal skin ratio. In melanoma extracts, the phosphorylcholine (PC)/glycerophosphorylcholine (GPC): Ala, Glu: Ser, and lactate: Ala ratios were five-, three-, and two-fold higher, respectively, than normal skin and the Val: Leu/Ile ratio was two-thirds of normal skin. With heat treatment, PC/GPC: Ala and Glu: Ser ratios decreased, whereas lactate: Ala and Val: Leu/Ile ratios increased three-fold and one-third, respectively. Results indicate that 1H NMR spectroscopy is a sufficiently sensitive technique to distinguish normal from diseased skin. The main attraction of this technique lies in the possibility of non-invasive study of various skin diseases, malignant transformation of benign tumors, and responses to treatment. Several methodologic problems remain to be resolved before a meaningful interpretation of in vivo observations becomes feasible. Correlation of in vivo and in vitro findings is an essential step toward this goal.

Adult↗
PubMed1988

Comparison of experimentally determined protein structures by solution of Bloch equations.

Nuclear Overhauser enhancement (NOESY) spectra were theoretically generated by solving the generalized Bloch equations with the appropriate initial conditions. The input to the equations were the coordinates of the protons of two similar crystal structures of basic pancreatic trypsin inhibitor. The two NOESY spectra obtained were compared to published experimental spectra of the protein in solution. It was found that the two crystal structures of basic pancreatic trypsin inhibitor give different theoretical spectra. The solution of the Bloch equations is very sensitive to small variations in the distance between protons (approx. 0.2 A), and to differences in the surrounding configurations. The method allows a detailed comparison of the crystal and solution structures of proteins. The structure of the trypsin inhibitor in solution was found to be similar to either one or the other crystal forms in different regions of the molecule.

Aprotinin↗
PubMed1988

A description of conformational transitions in the Pribnow box of the trp promoter of Escherichia coli.

Selective changes in the NMR parameters of the sequence of CGTACTAGTTAACTAGTACG, which corresponds to the trp operator of Escherichia coli, were observed as a function of temperature. The changes were localized to the sequence TTAA in the Pribnow box (underlined). Differential changes in chemical shift were analyzed in terms of a three-state model (states I, II, and III) to give the equilibrium constants, enthalpy changes, and populations. The midpoints of the first and second transitions were 9 and 30 degrees C, with enthalpy changes of 58 and 35 kcal/mol, respectively. Measurement of the spin-lattice and cross-relaxation rate constants at different temperatures allowed some structural conclusions to be drawn about the nature of the transitions. The line width of the H2 of A11 goes through a maximum at about 30 degrees C, indicating moderately fast exchange between the states. The rate constants for exchange at the midpoints were about 200 (I----II) and 250 (II----III) s-1. Taking these findings into account, we propose a mechanism for the interaction between RNA polymerase and the promoter. This mechanism can explain the temperature dependence observed for the initiation of transcription.

Base Sequence↗