PubMed Health⌕ Search

Biomedical subjects

O S Fedorova

Publications and source records attributed to O S Fedorova.

At least 19 recordsLinked to original sources
PubMed2004

Catalytic enantioselective synthesis of 18F-fluorinated alpha-amino acids under phase-transfer conditions using (S)-NOBIN.

We describe a new method for the asymmetric synthesis of [(18)F]fluorinated aromatic alpha-amino acids (FAA) under phase transfer conditions using achiral glycine derivative NiPBPGly and (S)-NOBIN as a novel substrate/catalyst pair. The key alkylation step proceeds under mild conditions. Substituted [(18)F]fluorobenzylbromides were prepared using nucleophilic [(18)F]fluoride and were used as alkylation agents. Two important FAA, 2-[(18)F]fluoro-L-tyrosine (2-FTYR) and 6-[(18)F]fluoro-L-3,4-dihydroxyphenylalanine (6-FDOPA), were synthesized with an ee of 92 and 96%, respectively. The total synthesis time was 110-120 min and radiochemical yields (d.c.) were 25+/-6% for 2-FTYR and 16+/-5% for 6-FDOPA.

2-Naphthylamine↗
PubMed2000

[The synthesis of a cobalt(II) tetracarboxyphthalocyanine- deoxyribooligonucleotide conjugate as a reagent for the directed DNA modification].

The cobalt(II) tetracarboxyphthalocyanine-deoxyribonucleotide pd(TCTTCCCA) conjugate was synthesized. The phthalocyanine N-succinimide ester prepared from phthalocyanine using DCC was mixed in DMF with an aqueous solution of the oligonucleotide bearing a 1,3-diaminopropane linker at the 5'-phosphate. The resulting conjugate was tested in the intraduplex reaction with target 14-mer and 22-mer oligonucleotides containing conjugate-complementary sequences. In the presence of O2 and a thiol (2-mercaptoethanol or DTT) as a coupled reducer or H2O2, sequence-specific DNA modification was observed that caused the cleavage of the target upon treatment with piperidine.

Animals↗
PubMed1999

Cooperative binding of oligonucleotides to adjacent sites of single-stranded DNA: sequence composition dependence at the junction.

The quantitative parameters of cooperative binding of deoxyribooligonucleotides to adjacent sites by double helix formation have been determined as a function of sequence composition at the junction. The base stacks 5'-Py/p-Py-3', 5'-Pu/p-Py-3' and 5'-Pu/p-Pu-3' (p is phosphate group, Py and Pu are pyrimidine and purine nucleoside, respectively) including mismatches on the 3'-side of the junction were studied using complementary addressed modification titration (CAMT) at 25 degrees C and pH 7.5, 0.16 M NaCl, 0.02 M Na2HPO4, 0.1 mM EDTA. The equilibrium binding constants of alkylating derivatives of 8-mer oligonucleotides (reagents) with 22-mer oligonucleotides (targets) were determined using the dependence of the target limit modification extents on the concentrations of the reagents. The parameters of cooperativity were calculated as the ratio of binding constants of reagents in the presence and the absence of a second 8-mer oligonucleotides (effectors) occupying the adjacent site on the 22-mer targets. For the stacks 5'-Py/p-Py-3' the parameters of cooperativity were around unity both for matched and mismatched nucleotides at the junction indicating the absence of cooperativity. The parameters of cooperativity for the stacks 5'-Pu/p-Pu-3' were higher than for the stacks 5'-Pu/p-Py-3' in perfect and non-perfect duplexes. Discrimination of mismatches was higher in nicked than in normal duplexes.

Alkylation↗
PubMed1999

Structural requirements of double and single stranded DNA substrates and inhibitors, including a photoaffinity label, of Fpg protein from Escherichia coli.

Fpg protein (formamidopyrimidine or 8-oxoguanine DNA glycosylase) from E. coli catalyzes excision of several damaged purine bases, including 8-oxoguanine and 2,6-diamino-4-hydroxy-5-N-methylformamidopyrimidine from DNA. In this study the interaction of E. coli Fpg with various specific and nonspecific oligodeoxynucleotides was analyzed. Fpg was shown to remove 8-oxoguanine efficiently, not only from double-stranded, but also from single-stranded oligodeoxynucleotides. The Michaelis constants (KM) of a range of single-stranded oligodeoxynucleotides (0.55-1.3 microM) were shown to be 12-170 times higher that those for corresponding double-stranded oligodeoxynucleotides (KM = 6-60 nM). Depending on the position of the 8-oxoguanine within the oligodeoxynucleotides, relative initial rates of conversion of single-stranded substrates were found to be lower than, comparable to, or higher than those for double-stranded oligodeoxynucleotides. The enzyme can interact effectively not only with specific, but also with nonspecific single-stranded and double-stranded oligodeoxynucleotides, which are competitive inhibitors of the enzyme towards substrate. Fpg became irreversibly labeled after UV-irradiation in the presence of photoreactive analogs of single-stranded and double-stranded oligodeoxynucleotides. Specific and nonspecific single-stranded and double-stranded oligodeoxynucleotides essentially completely prevented the covalent binding of Fpg by the photoreactive analog. All these data argue for similar interactions occurring in the DNA binding cleft of the enzyme with both specific and nonspecific oligodeoxynucleotides. The relative affinities of Fpg for specific and nonspecific oligodeoxynucleotides differ by no more than 2 orders of magnitude. Addition of the second complementary chain increases the affinity of the first single-stranded chain by a factor of approximately 10. It is concluded that Michaelis complex formation of Fpg with DNA containing 8-oxoG cannot alone provide the major part of the enzyme specificity, which is found to lie in the kcat term for catalysis; the reaction rate being increased by 6-7 orders of magnitude by the transition from nonspecific to specific oligodeoxynucleotides.

Base Sequence↗
PubMed1999

Real-time oligonucleotide hybridization kinetics monitored by resonant mirror technique.

The kinetics of hybridization of 11-meric and 14-meric oligonucleotides, dTGGGAAGAGGG (ODN-11) and dTGGGAAGAGG GTCA (ODN-14), with 14-meric oligonucleotide dpTGACCCTCT TCCCA (p14) attached to the surface of a cuvette was studied by the resonant mirror method. The treatment of the experimental curves with exponential equations leads to the following values for association (kas) and dissociation (kdis) rate constants at 25 degrees C: kas = 219 +/- 39 and 183 +/- 162 M-1 s-1, kdis = (2.0 +/- 0.4) x 10(-3) and (4 +/- 1) x 10(-4) s-1 for the duplexes (p14) x (ODN-11) and p14 x (ODN-14), respectively. The oligonucleotide dTGCCTTGAATGGGAA GAGGGTCA (ODN-23), which forms a hairpin structure, does not associate with p14. The data were compared with the results of melting curve detection and temperature-jump experiments. The association rate constants for ODN-11 and ODN-14 are much slower than those values in homogeneous aqueous solution. The dissociation rate constants have the same magnitude values as estimated by using association constants measured from melting curves but differ from the values estimated in temperature-jump experiments.

Biosensing Techniques↗
PubMed1997

A series of meso-tris (N-methyl-pyridiniumyl)-(4-alkylamidophenyl) porphyrins: synthesis, interaction with DNA and antibacterial activity.

A series of meso-5,10,15-tris(N-methyl-4-pyridiniumyl)-20-(4-alkylamidophen yl) porphyrins were synthesized by derivatizing the amino group on the phenyl ring with the following hydrophobic groups: -C(O)C7F15, -C(O)CH=CH2, C(O)CH3, -C(O)C7H15, and -C(O)C15H31. The cationic tris-pyridiumyl porphyrin core serves as a DNA binding motif and a photosensitizer to photomodify DNA molecules. The changes of the UV-Vis absorption spectra during the titration of these porphyrins with calf thymus DNA revealed a large bathochromic shift (up to 14 nm) and a hypochromicity (up to 55%) of the porphyrins Soret bands, usually considered as proof of porphyrin intercalation into DNA. Association constants (K) calculated according to the McGhee and von Hippel model, were in the range of 10(6)-10(7) M(-1). An increase in hydrophobicity of the substituents at the 20-meso-position produced higher binding affinity. These porphyrins caused photomodification of the supercoiled plasmid DNA when a green laser beam at 532 nm was applied. Those with higher surface activity acted more efficiently as DNA photomodifiers. The porphyrin with a perfluorinated alkyl chain (-COC7F15) at the meso-20-position inhibited the growth of gram-positive bacteria (S. aureus, or S. epidermidis). Other porphyrins exhibited moderate activity against both gram-negative and gram-positive organisms.

Anti-Bacterial Agents↗
PubMed1997

Cooperative interactions of the oligodeoxyribonucleotides on the complementary template. The influence of chemical groups and mismatched nucleotides at the 5'- and 3'-ends of oligonucleotides on the parameters of cooperativity.

Parameters of cooperative interactions of two or three oligodeoxyribonucleotides or their derivatives bound with the adjacent sites of the complementary template were measured using method of "complementary addressed modification titration" (CAMT). Complementary template (target) were modified with the reactive oligonucleotide derivatives (reagents) bearing covalently attached alkylating 4-[N-(2-chloroethyl)-N-methylamino]benzylamino- group (C1RCH2NH)- at 5'-terminal phosphate. The targets had only one binding site for the reagent and either no (T10), or one (T'22 and T22) or two sites (T26) for the oligonucleotides (effectors) cooperatively bound with the adjacent sites on the template. Both unmodified oligonucleotides E1, E2 and their derivatives E1Phn, E2Phn bearing N-(2-hydroxyethyl)-phenazinium residues Phn- both at 5'- and 3'-ends covalently linked via ethylenediamine linker were used as effectors. Effectors E1 and E2 (E1Phn and E2Phn) bind, respectively, upstream or downstream from the reagent. Hexameric (X6) or octameric (X8 or X8m) reagents were used for the target modification. The reagent X8m formed one TT-mismatch with the target at the end opposite to location of the reactive moiety. The cooperativity parameter values characterizing the mutual interactions between the reagents X6, X8, X8m and effectors E1, E2, E1Phn, E2Phn have been found as the ratio of the association constants of the reagents in the presence of effectors. The association constants were calculated from the dependencies of the target modification extent on initial concentrations of the reagents. The use of T26 existing both in linear and hairpin conformations permitted us to estimate additionally the role of indirect cooperativity originating from the induction of the target conformational change by the effectors. The following conclusions were done from the quantitative results. The efficiency of direct cooperativity is independent on the length of oligonucleotide for the same nature of the contact. The cooperativity parameter increases by factor about 3 in the presence of Phn-group covalently attached to oligonucleotides and located at the junctions. The presence of either alkylating group C1RCH2NH- or TT-mismatch at the junctions eliminates cooperative interaction between the bases. In the same time sufficiently effective cooperative interaction takes place in the case of simultaneous presence of both Phn- and either C1RCH2NH- group or TT-mismatch at the junction.

DNA, Complementary↗
PubMed1997

[Study of the secondary structure of a single-stranded DNA fragment using self-modification reaction].

Electrophoretic analysis of the products of chemical destruction at modified base residues was used to determine the site-directedness of self-alkylation of the 26-mer DNA fragment pTTGCCTTGAATGGGAAGAGGGTCATT (T26). This fragment possesses a 4-[N-methyl-N-(2-chloroethyl)amino]benzylamido group (CIR-), covalently attached to the 5'-terminal phosphate group both in the presence and in the absence of the oligonucleotide effector (Phn-L)pTGACCCTCp(L-Phn), where Phn is an N-(2-hydroxyethyl)phenazinium residue and L is an ethylenediamine linker. Molecular modeling with the method of molecular mechanics/dynamics (MM/D) was used to investigate the secondary structure of the CIR-T26 conjugate and to interpret the change of the alkylation site upon treatment with CIR-T26 in the presence of an effector.

Alkylation↗
PubMed1997

[Photomodification of DNA with a perfluorylazide-derived oligonucleotide].

The kinetics of photomodification of oligodeoxyribonucleotide pd(GTGTGA) with a derivative of the complementary oligodeoxyribonucleotide pd(CACACA) bearing a 3-(n-azidotetrafluorobenzoylamino)propylamine residue (ArN3) at the terminal phosphate group was studied at 20 degrees C. It was found that the target's G3 residue is preferentially modified. Along with the transformation of the arylazide moiety, degradation of the oligonucleotide fragment of the reagent occurred with a partial loss of affinity. With the use of the reagent labeled at the 5'-end, sites of photomodification were found. From the dependence of the modification level on the reagent concentration at the initial time of irradiation, the association constant (Kx = (1.40 +/- 0.24) x 10(5) M-1) was determined. From the dependence of the modification level on the concentration of the pre-irradiated reagent, the constant of the transformed reagent-target association in solution (Kr = (2.49 +/- 0.30) x 10(4) M-1) was determined. From the time-dependence of the modification level [PZ]/P0, the rate constant for the limiting step of photomodification (k0 = (5.31 +/- 0.28) x 10(-4) S-1) and the modification efficiency of the target in the complex with the reagent (gamma = 1) were found.

Autoradiography↗
PubMed1995

Cooperative interactions in the tandem of oligonucleotide derivatives arranged at complementary target. Quantitative estimates and contribution of the target secondary structure.

The intraduplex reaction of the alkylating reagent CIRCH2NHpd(TTCCCA) (X, ClR is p-(N-2-chloroethyl-N-methylaminophenyl) residue) with the target 26-mer d(TTGCCTTGAATGGGAAGAGGGTCATT) (P) in the presence of effectors was studied. The effectors used were Phn-L-pd(TTCAAGGC)p-L-Phn (E1) and Phn-L-pd(TGACCCTC)p-L-Phy (E2), where Phn is N-(2-hydroxyethyl)-phenazinium residue and L is NHCH2CH2NH spacer. The dependence of the alkylation extent of the target on the reagent concentration was treated using the equation derived earlier for the two-component system (reagent + target) to calculate association constants of X with P, PE1, PE2 and PE1E2. The latter were found to be Kxe1 = 6.75 x 10(5) M-1, Kxe2 = 4.15 x 10(4) M-1 and Kxe12 = 5.87 x 10(6) M-1 as compared with the affinity of X to P Kx = 2.16 x 10(4) M-1 in the absence of effectors. Taking into account the internal structure of the target, co-operativity parameters describing interactions in the tandem E1 x X x E2 arranged at the target were calculated as alpha 1 = 16, alpha 2 = 10 and alpha 12 = 139 for the duplexes PXE1, PXE2 and PXE1E2.

Alkylating Agents↗
PubMed1995

Thermodynamic and structural features of cooperative interactions in tandem oligonucleotide derivatives arranged at the complementary template. Chemical modification data.

General equations are derived for the limit yield [PZ] infinity of the intraduplex reaction between reactive oligonucleotide derivative X bearing p-(N-2-chloroethyl-N-methyl-amino)phenyl residue and oligonucleotide target P encompassing the sequence complementary to X in the presence of one or two oligonucleotide effectors E1 and E2. The latters form the complementary tandem sequence E1-X-E2 at the target. It is shown that association constants characterizing the affinity of the reagent X to the effector containing complexes PE1, PE2 and PE1E2 may be calculated from the dependencies of [PZ] infinity on the initial concentration chi 0 of X providing the sufficient excess of effectors is present. The approach was applied to reaction of C1RCH2NHpd(TTCCCA) with 26-mer dTTGCCTTGAATGGGAAGAGGGTCATT and effectors Phn-L-pd(TTCAAGG-C)p-L-Phn(E1) and Phn-L-pd(TGACCCTC)p-L-Phn(E2) where Phn- is N-(2-hydroxyethyl)-phenazinium residue and L is -NHCH2CH2NH- spacer. The association constants were found to be Kxe1 = 6.75 x 10(5)M-1, Kxe2 = 4.15 x 10(4)M-1 and Kxe12 = 5.87 x 10(6)M-1 as compared with the affinity of X to P Kx = 2.16 x 10(4)M-1 in the absence of effectors. The experiments on self-alkylation of target reactive derivative C1RCH2NHpd(TTGCCTTGAATGGGAAGAGGGTCATT) both in the presence and in the absence of effector E2 as well as the Molecular Mechanics calculations of its prereactive states showed target to form the hairpin secondary structure. Under reasonable suggestions taking into account the internal structure of the target co-operativity parameters describing the contribution of interactions of the terminal nucleotides of X with adjacent residues of effector were calculated and found to be alpha 1 = 16, alpha 2 = 10 and alpha 12 = 139 for the duplexes PXE1, PXE2 and PXE1E2, respectively.

Base Sequence↗
PubMed1995

[Kinetics of DNA photomodification by derivatives of 1-(3-(p-azidotetrafluorobenzoyl)aminopropyl)-5'-phosphamides of oligodeoxyribonucleotides in model duplexes].

Kinetics of photomodification of 26-meric deoxyribonucleotide pTTGCCTTGAATGGGAA-GAGGGTCATT with derivatives of the complementary oligonucleotides pTCTTCCCATTC, pTCTTCCCA, and pTTCCCA bearing a residue of (p-azidotetrafluorobenzoyl)aminopropylamine(-ArN3) attached to the terminal phosphate (reagents I, II, and III, respectively) was studied at 37 degrees C. It was established that during irradiation the reagents are inactivated, loosing their affinity to the target. A kinetic equation describing the modification was suggested. From the dependence of the time-limited modification level on the reagent concentration, the association constants of the reagents with the target were determined: [Kx = (9.9 +/- 0.4) x 10(4), (1.1 +/- 0.1) x 10(5), and (8.4 +/- 2.1) x 10(6) M-1 for reagents I, II, and III, respectively] and the efficiency of the modification in the complex gamma ef (ca. 0.3 for all the reagents) were determined. From the dependence of the modification level [PZ]/p0 on time for reagent II, the rate constant was determined for the rate-determining step of the photomodification k0 = (7.9 +/- 0.9) x 10(-3) s-1, which is close to the rate constant for the photolysis of p-azidotetrafluorobenzoic acid kp = (5.5 +/- 0.3) x 10(-3) s-1.

Azides↗
PubMed1995

[Cooperative interactions of oligodeoxyribonucleotides upon binding with DNA by chemical modification].

Quantitative characteristics of the modification of deoxyribooligonucleotide TTGCCTTGAATGG-GAAGAGGGTCATT (P) with 4-(N-2-chloroethyl-N-methylamino)benzyl phosphamide derivative of oligonucleotide pTTCCCA (X) were studied. The modification was performed in the presence of derivatives of the oligonucleotides (Phn-L)pTTCAAGGCp(L-Phn) (E1) and (Phn-L)pTGACCCTCp(L-Phn) (E2), where Phn is the residue of N-(2-hydroxyethyl)phenazinium, and L is ethylene diamine spacer. In PXE1, PXE2, and PXE1E2 complexes, E1, E2, and reagent X are bound with target P in tandem, with E1 near the 3'-end and E2 near the 5'-end of the reagent X. From the dependences of the maximum in time modification degree of target P and the shorter targets containing the complementary binding site for the reagent X on its concentration, the association constants of the complexes PX, PE1, and PE2 were determined as Kx = (4.2 +/- 0.6) x 10(4) M-1, Ke1 = (1.25 +/- 0.44) x 10(7) M-1, and Ke2 = (2.56 +/- 1.22) x 10(6) M-1, respectively. The cooperativity coefficients of joint binding the X, E1, and E2 with the target giving rise to the complexes PXE1, PXE2, and PXE1E2 were estimated as alpha 1 = 15.7 +/- 2.1, alpha 2 = 8.7 +/- 1.2, and alpha 12 = 136.5 +/- 2.6, respectively. The data obtained suggest that E2 is not only the effector of modification but it is also an inhibitor due to the formation of the complex PE2* with Ke2* = (1.97 +/- 1.27) x 10(7) M-1 not capable of adding the reagent X.

Base Sequence↗
PubMed1993

Kinetic study of the addressed modification by hemin derivatives of oligonucleotides.

Kinetics of oligonucleotide pd(TGAATGGGAAGA) modification by a hemin derivative of the complementary oligonucleotide pd(TTCCCATT) in the presence of hydrogen peroxide was investigated. The treatment of experimental data permitted to evaluate the association and rate constants at 25 degrees C: Kx = (3.40 +/- 0.38) x 10(5) M-1 (association constant of the reagent with the target), kd = 152 +/- 6 M-1 min-1 (degradation constant of the hemin group of the reagent in a parallel reaction), ko = 51.0 +/- 1.7 M-1 min-1 (target modification constant in the reactive duplex). The modification of DNA is incomplete due to competition of the modification reaction with the degradation of the hemin group of the reagent in a parallel reaction.

Base Sequence↗
PubMed1992

Interaction of human and Escherichia coli tRNA(Phe) with human 80S ribosomes in the presence of oligo- and polyuridylate templates.

Human placenta and Escherichia coli Phe-tRNA(Phe) and N-AcPhe-tRNA(Phe) binding to human placenta 80S ribosomes was studied at 13 mM Mg2+ and 20 degrees C in the presence of poly(U), (pU)6 or without a template. Binding properties of both tRNA species were studied. Poly(U)-programmed 80S ribosomes were able to bind charged tRNA at A and P sites simultaneously under saturating conditions resulting in effective dipeptide formation in the case of Phe-tRNA(Phe). Affinities of both forms of tRNA(Phe) to the P site were similar (about 1 x 10(7) M-1) and exceeded those to the A site. Affinity of the deacylated tRNA(Phe) to the P site was much higher (association constant > 10(10) M-1). Binding at the E site (introduced into the 80S ribosome by its 60S subunit) was specific for deacylated tRNA(Phe). The association constant of this tRNA to the E site when A and P sites were preoccupied with N-AcPhe-tRNA(Phe) was estimated as (1.7 +/- 0.1) x 10(6) M-1. In the presence of (pU)6, charged tRNA(Phe) bound loosely at the A and P sites, and the transpeptidation level exceeded the binding level due to the exchange with free tRNA from solution. Affinities of aminoacyl-tRNA to the A and P sites in the presence of (pU)6 seem to be the same and much lower than those in the case of poly(U). Without a messenger, binding of the charged tRNA(Phe) to 80S ribosomes was undetectable, although an effective transpeptidation was observed suggesting a very labile binding of the tRNA simultaneously at the A and P sites.

Binding Sites↗
PubMed1992

The influence of the target structure on the efficiency of alkylation of single-stranded DNA with the reactive derivatives of antisense oligonucleotides.

Site-directed alkylation of three oligonucleotide targets: 41-mer (hairpin structure), 22-mer (loop part of this hairpin) and 10-mer (part of the loop) with 5'-p-(N-2-chloroethyl-N-methylamino)benzylamides of oligonucleotides complementary to the loop region was studied. Thermodynamic parameters of the interaction were estimated using the dependence of the limit modification extent on the reagent concentration at several temperatures. The stability of the complex increases significantly in the set: 302-mer carrying above hairpin, 41-mer, 22-mer, the data for 22-mer and 10-mer being nearly identical. This indicates significant influence of the loop supporting structure on the interaction with antisense reagents.

Alkylation↗
PubMed1992

Selective inhibition of the polypeptide chain elongation in eukaryotic cells.

The effect of Cephalotaxus alkaloids--homoharringtonine and cephalotaxine--on translation in a cell-free system from rabbit reticulocytes and on phenylalanine polymerisation by human ribosomes was studied. The effect of the alkaloids on the nonenzymatic and the eEF-1-dependent Phe-tRNA(Phe) binding to poly(U)-programmed 80S ribosomes, diphenylalanine synthesis accompanying nonenzymatic Phe-tRNA(Phe) binding and acetylphenylalanyl-puromycin formation was examined. Homoharringtonine was shown to inhibit the formation of diphenylalanine and acetylphenylalanyl-puromycin catalysed by human and rat liver ribosomes, but was inactive as an inhibitor on the E. coli elongation system. Neither nonenzymatic nor enzymatic Phe-tRNA(Phe) binding was noticeably affected by the alkaloid. It has been proposed that the site of homoharringtonine binding to 80S ribosomes should overlap or coincide with the acceptor site of the ribosomal peptidyl transferase centre. The association constant of homoharringtonine for 80S human ribosomes was estimated to be (2.57 +/- 0.33).10(7) M-1 in the presence of puromycin. Cephalotaxine did not exert a significant influence on the polypeptide chain elongation.

Animals↗