PubMed Health⌕ Search

Biomedical subjects

R Bamezai

Publications and source records attributed to R Bamezai.

At least 19 recordsLinked to original sources
PubMed2005

Novel variations in the signal peptide region of transforming growth factor beta1 gene in patients with hepatitis: a brief report from India.

Genotypic status of the signal peptide region of transforming growth factor beta1 (TGF-beta1) showed a significant difference in C/C-genotype frequency at +29 position (codon 10) between a range of viral hepatitis patients and controls (P = 0.009, OR = 3.15, CI = 1.29-7.678), contributed by those who were infected with hepatitis B virus (HBV) alone or HBV + hepatitis delta virus (HDV) (P = 0.003, OR = 5.0, CI = 1.78-13.97).

5' Untranslated Regions↗
PubMed2005

Promoter and intron-1 region polymorphisms in the IFNG gene in patients with hepatitis E.

Allelic and genotype variations in the promoter region and the dinucleotide (CA)(n) repeat region in intron 1 of the interferon-g (IFNG) gene were analysed by direct sequencing and simple sequence length polymorphism (SSLP), respectively, in patients with acute hepatitis, and the prevalence was compared with that in healthy controls. Our results showed a significant association of heterozygous genotypes (CA)12/(CA)14 and (CA)12/(CA)16 in intron 1 of the IFNG gene in all categories of patients with acute hepatitis, classified on the basis of presence or absence of hepatitis E virus (HEV), in comparison with healthy controls. A novel polymorphism, -288 A-->T [from the translational start site, as per Human Genome Organization (HUGO) nomenclature], in the promoter region of the IFNG gene leading to a loss of the consensus domain for the interferon-stimulated response element (ISRE), as predicted by in silico analysis, was observed in 12.5% of patients with acute HEV infection. However, no significant difference in allele or genotype frequency was observed for the -288 promoter polymorphism, although the heterozygous -288 A/T genotype showed a moderate risk in patients with acute HEV infection alone (P = 0.29, odds ratio = 1.964, confidence interval = 0.46-8.45). The data suggest that the genotype at intron 1 of IFNG might affect susceptibility to acute hepatitis in HEV infection, which warrants further elucidation in a larger sample and also functional studies.

Dinucleotide Repeats↗
PubMed2004

Dominant negative effect of novel mutations in pyruvate kinase-M2.

The natural mutations observed in pyruvate kinase (PK)-M2, a homotetramer isozyme, in this study correlated with the differential activity of the enzyme in a dominant negative manner in B-lymphoblastoid cells, established from two Bloom syndrome (BS) patients, BS1 and BS3 by 50 and 90%, respectively; and by 75% in the freshly obtained PHA stimulated lymphocytes of a BS patient diagnosed for the first time in India. A gene screen involving the critical domains of the PK-M gene in BS cells resulted in the observation of a missense mutation in BS1 and the BS patient and a frame shift mutation in BS3, in exon-10, coding for the intersubunit contact domain (ISCD) of the PK-M2 protein. Apart from these mutations, other variations in this region of the gene, both in normal and BS cells, did not affect the enzyme activity, since these were silent. Computer-based modeling studies of the PK-M2 protein with each mutation was suggestive of a changed interaction between two domains within a subunit in BS1, a gross structural change in BS3, and a changed interaction between two subunits of the tetramer in the BS patient. An absence of such mutations in other regions of the PK-M2 gene in normal subjects and in the randomly chosen unrelated genes in the DNA from BS cell lines and the cells from the BS patient, authenticated the presence of the observed mutations in Bloom syndrome cells. A correlation observed between the differential enzyme activity and the nature of mutation in the intersubunit contact domain (ISCD) region of the PK-M2 gene was interesting, and indicted how the site and the nature of mutation in a heterozygous state could influence the enzyme activity differentially and in a dominant negative manner. The importance of these mutations in Bloom syndrome cells, however, remains to be elucidated, and can only be conjectured.

Amino Acid Sequence↗
PubMed2004

Transforming growth factor-beta1 genotype in sporadic breast cancer patients from India: status of enhancer, promoter, 5'-untranslated-region and exon-1 polymorphisms.

Transforming growth factor beta (TGF-beta) is an example for a large and still-growing family of growth factors. TGF-beta1 is known to act both as a tumour suppressor and as a stimulator of tumour progression. This study examines the relationship amongst putative enhancer, promoter, 5'-untranslated-region (UTR) and exon-1 polymorphisms of the TGF-beta1 gene (region I from -1881 to -1613; region II from -1410 to -1123, and region III from -55 to +176, as per human genome organisation (HUGO) nomenclature) in 26 breast cancer patients and 97 healthy control subjects. The germline and somatic status of the four known polymorphisms was ascertained, and a significant difference was observed for the germline C/T and T/T genotype distribution between patients and controls in comparison to C/C genotypes at position -1349 (chi2 = 6.193; P = 0.009). In addition to the somatic variations observed for some of the regions studied, in 10/26 (38%) sporadic breast cancer cases, a novel somatic mutation in codon 47 of exon 1 (GenBank accession number AY059373) was also detected in tumour samples. The risk of cancer was found to be significant (OR = 4.525) for the -1349 C/T and T/T genotype background, suggesting that this genetic background may act as a risk factor for sporadic breast cancer.

5' Untranslated Regions↗
PubMed2003

Two novel somatic mutations in the human interleukin 6 promoter region in a patient with sporadic breast cancer.

Two new single nucleotide mutations were observed within the promoter region of human interleukin-6 gene (IL-6) in the tumour sample of a patient with sporadic breast cancer, which was a somatic change. Both mutations, one at -125 (C > G) and the other at position -173 (G > T) from the translation start site, were transversions observed at new positions, not reported earlier. In addition to these two novel mutations in this patient, a known somatic polymorphism was also observed at position -174 (G > C) (from the transcription initiation site, redesignated as -236 from the translational initiation site as per the HUGO nomenclature). Further, a preliminary comparative analysis of the studied promoter region by the 'ConsInspector 3.0' program, where the mutated sequence (AF362378) was compared with the sequence existing in the database (Y00081), depicted the presence of the variations in putative binding sites for transcription factors such as glucocorticoid response element (GRE) and nuclear factor kappa-B (NFkappa-B), which could lead to differential expression of this gene.

Base Sequence↗
PubMed2000

Detection of genetic variation in Indian population groups using a novel minisatellite probe and finding relationships through tree construction.

Genetic variation in HaeIII-digested genomic DNA samples from different individuals belonging to population groups from Bengal, Uttar Pradesh (UP), Punjab, and South India was assessed at hypervariable loci, using a minisatellite probe, pBA1.2 (accession number, AF 157691), the repeat unit of which was 24 mer long and rich in G-bases. Comparison of DNA profiles between individuals showed a very low probability of band sharing, which ranged from 0.18 to 0.24. A dendrogram, based on Nei's genetic distance, constructed by the neighbor-joining method, showed the formation of separate clusters by both South Indian and non-Indian samples, whereas the construction of a dendrogram based on the Unweighted pair group method arithmetic average (UPGMA) method with Jaccard's similarity coefficient at the individual level led to the formation of several small clusters which were interleaved; also, the subgroups for each of the populations were intermingled with the subgroups for the other populations. A separate analysis was carried out to check the consistency of the proximity between different individuals forming a cluster and between those individuals who were in the vicinity of two clusters. The dendrograms thus obtained did not change the relationship between the individuals from all the populations studied. Despite the distinct clustering observed in the population group comparison, a probable admixture was reflected in the finding that some individuals belonging to one population group were dispersed or embedded within a cluster generated by the individuals of another population group, when a minute dissection of the data for generating a tree at the individual level was carried out.

DNA Fingerprinting↗
PubMed2000

Direct and translactational effect of arecoline alkaloid on the clocimum oil-modulated hepatic drug metabolizing enzymes in mice.

The present study assesses the potential of arecoline alkaloid, by direct exposure in lactating dams and translactational exposure in neonates, to modulate the efficacy of clocimum oil as a blocking agent in chemopreventive pathway. Clocimum oil (25 or 50 microl/dam/day) induced a significant increase in the hepatic levels of phase II glutathione S-transferase (GST) and acid-soluble sulfhydryl in lactating dams and suckling neonates while the elevated levels of hepatic phase I cytochrome b5 (Cyt. b5) and cytochrome P-450 (P450) were observed only in the dams. Arecoline (0.6 mg/dam/day) alone did not modulate the hepatic GST and sulfhydryl levels in either dams or pups, although significant induction was observed in the hepatic levels of Cyt. b5, P450 and malondialdehyde (MDA) in lactating dams and suckling neonates. Clocimum oil-modulated hepatic levels of phase II components were depressed whereas phase I enzymes and lipid peroxides levels were further elevated by clocimum oil-plus-arecoline treatment. The direct or translactationally augmented levels of bioactivated species of the administered compounds, via enhanced phase I oxidative catalysis and less efficient GST/GSH conjugational detoxication, may suggest the antagonistic influence of arecoline on chemopreventive efficacy of clocimum oil.

Animals↗
PubMed2000

Characterization of a subcloned fragment (pBA0.6) of pCMM86 located on 17q21 and its potential use in generating an individual-specific DNA profile.

Sequence analysis was carried out of a human clone pBA0.6 generated after exonuclease III/S1 nuclease digestion and subcloning of pCMM86 (GDB: 168382, D17S74), which was not available in the database. It revealed the presence of a reiterating core motif of 24mer GTGGGTGTGTTGGAGGGGGTGAGG, present 23 times, which was GC-rich and minisatellitic in nature. Genomic blots of HaeIII-digested human DNA, when hybridized with pBA0.6, generated a ladder of bands between 29.0 kb and 2.1 kb. Hybridization analyses of 88 unrelated individuals belonging to four regions of India using this probe revealed polymorphic bands which were individual specific. The probability of identity ranged from 5.07x10(-14) in Punjabis to 2.64x10(-16) in Bengalis and was found to be 3.06x10(-16) in UPites, whereas in the case of South Indians, it was 3.9x10(-15). Three sets of isomorphic bands at 29.0 kb, 2.4 kb, and 2.1 kb were common between the individuals of all the regions and served as internal markers. The 29.0-kb band was observed to be Homo sapiens specific. Construction of dendrograms based on the UPGMA method with Jaccard's coefficient values suggested less genetic similarity/high genetic diversity in all the population groups, indicating that the samples taken were random. Maximum likelihood estimates through the bootstrap sampling method showed that Punjabis, Bengalis, and UPites formed one cluster, whereas South Indians formed a separate cluster, altogether thus showing the proximity of these three population groups compared with that from South India. A preliminary study by Northern hybridization with pBA0.6 resulted in two transcripts of 0.63 kb and 0.29 kb. This finding was corroborated with RT-PCR results where 2 amplicons, matching the expected size of two open reading frames within the minisatellite sequence, were obtained. The role of the two transcripts from the minisatellite sequence is not clear as yet, and it is probable that these messages may not get translated because of the absence of a eukaryotic Kozak sequence around the initiator methionine in the pBA0.6 sequence.

Base Sequence↗
PubMed1999

Modulatory potential of clocimum oil on mouse skin papillomagenesis and the xenobiotic detoxication system.

The present study was designed to elucidate the mechanistic inhibitory efficacy of clocimum (an eugenol rich variety of Ocimum gratissimum; Labiatae) oil on murine skin papillomagensis. Topical application of clocimum oil (50 microl/animal/day) during peri-initiation stage (1 week before and 2 weeks after initiation) of 7,12-dimethylbenz[a]anthracene (DMBA)-induced papillomagenesis and/or during the tumour promotion stage reduced (P < 0.05) the (i) tumour burden to 5.00, 4.41 and 4.50 (positive control value 5.27); (ii) cumulative number of papillomas to 85, 75 and 72 (positive control value : 95); and (iii) percent incidence of mice bearing papillomas to 94, 89 and 88, respectively (positive control value 94). Significant (P < 0.01) elevation in the hepatic levels of glutathione S-transferase (GST), sulfhydryl (-SH) and cytochrome b5 (Cyt. b5) was observed by the respective topical treatment of clocimum oil. Even in the skin tissue of the mouse, the topical treatment of clocimum oil enhanced (P < 0.05) the -SH content. The results suggest the modest chemopreventive potential of clocimum oil against the murine skin papillomagenesis, and such effects may be partly due to the modulated xenobiotic detoxication system enzymes.

9,10-Dimethyl-1,2-benzanthracene↗
PubMed1998

T-cell receptor-gamma rearrangement and c-myb methylation in MNNG-exposed Bloom syndrome B-lymphoblastoid cells.

The MNNG-exposed Bloom syndrome (BS) B-lymphoblastoid cell population (BS-MNNG), when analyzed for aberrant genetic variations, showed an illegitimate rearrangement at the TCR-gamma gene and hypermethylation at the c-myb protooncogene. The TCR-gamma rearrangement involved a Vgamma9 segment corresponding to a 4 kb band detected with a Jgamma-specific probe in HindIII-digested DNA samples from BS-MNNG cells only. These variations were not shown by unexposed BS cells or both MNNG-exposed and unexposed normal (GA3) B-lymphoblastoid cells.

B-Lymphocytes↗
PubMed1998

MNNG-transformed Bloom syndrome B-lymphoblastoids for the detection of Hodgkin's lymphoma-associated antigen in 2D Westerns.

Twenty-four hour MNNG-exposed Bloom syndrome (BS) B-lymphoblastoid cells with the potential to form single cell colonies in soft agar and nude mouse tumour (2/6 (33%) showed a simultaneous increase in the Ras-expressing cells (using monoclonal antibody to p21 transforming protein) from 20% (at 24 h) to 85% (on day 30). In contrast, there was an absence of Ras-positive cells in MNNG-exposed fresh lymphocytes (PBMCs) from a healthy subject and a presence of only 11-18% of Ras-positive cells in normal (GA3) and unexposed BS B-lymphoblastoid cells. The Western blot analysis using sera samples from Hodgkin's lymphoma patients showed the presence of proteins of 102 and 68 kDa which in 2D Westerns were observed to be unique to BS-MNNG cells with approximate pIs of 5.3 and 5.7, respectively. It is proposed that BS-MNNG cells provide an interesting in vitro human cell model to generate unique cancer-associated antigen(s) in addition to using this system to understand the primary events associated with neoplastic transformation.

Antigens, Neoplasm↗
PubMed1998

Momordica charantia (Bitter Gourd) peel, pulp, seed and whole fruit extract inhibits mouse skin papillomagenesis.

The present study was designed to elucidate the inhibitory potential of Momordica charantia (Bitter Gourd) peel, pulp, seed and whole fruit extract on mouse skin papillomagensis with the modulatory influence of biotransformation system enzymes. Topical application of Momordica whole fruit extract (100 microl/animal per day) during the peri-initiation stage (1 week before and 2 weeks after initiation) by 7,12-dimethylbenz[a]anthracene (DMBA) and/or during the tumor promotion stage reduced the (i) tumor burden to 4.26, 3.72 and 3.11 (positive control value: 5.42); (ii) cumulative number of papillomas to 81, 67 and 53 (positive control value: 103); and (iii) percent incidence of mice bearing papillomas to 100, 94 and 94, respectively (positive control value: 100). In a comparison of the anticarcinogenic efficacy of Momordica peel, pulp, seed and whole fruit extract (100 microl/animal per day), after topical treatment during the peri-initiation and during the tumor promotion stage, revealed the modulation of the (i) tumor burden (tumors/mouse) to 3.06, 3.61, 3.17 and 3.11; (ii) cumulative number of papillomas to 49, 65, 54 and 53; and (iii) percent incidence of mice bearing papillomas to 84, 100, 94 and 94, respectively. Significant elevation in the sulfhydryl (-SH) level was observed in the liver and skin tissues by the topical treatment of Momordica peel, pulp, seed and whole fruit extract. Elevation in the hepatic levels of cytosolic glutathione S-transferase (GST) and microsomal cytochrome b, was also observed by the topical treatment of Momordica peel, seed and whole fruit extract. The results suggest the maximum chemopreventive potential is in the Momordica peel. Equivocal efficacy is in the Momordica seed and whole fruit extract. Biotransformation system enzymes may be the cause of this reduced papillomagenesis.

Animals↗
PubMed1998

Postnatal efficacy of Momordica charantia peel, pulp, seed and whole fruit extract in the detoxication pathway of suckling neonates and lactating mice.

The present study evaluates the postnatal efficacy of Momordica charantia peel, pulp, seed and whole fruit extract via assessing the modulation in the biotransformation system enzymes of suckling neonates and lactating mice. The peel, seed or whole fruit extract of Momordica (100 microl/animal/day) independently induced a significant increase in the hepatic levels of glutathione S-transferase (GST) and acid soluble sulfhydryl (-SH) after 14 or 21 days treatment in lactating dams (P < 0.01) and translactationally exposed neonates (P < 0.05). However, the elevation (P < 0.05) in hepatic cytochrome b5 (Cyt. b5) and cytochrome P-450 (Cyt. P-450) levels was observed only in the lactating dams treated with the respective extracts of peel, seed or whole fruit of Momordica. In lactating dams and suckling neonates the modulated levels of biotransformation system enzymes suggest the potential for the translactational passage of active principle(s) and/or metabolites of Momordica.

Animals↗
PubMed1997

Postnatal efficacy of antioxidants in the detoxification pathway of suckling neonates and lactating mice.

This study evaluates the comparative efficacy of antioxidant vitamins (ascorbic acid and alpha-tocopherol) and non-vitamin antioxidants (glutathione, cysteine and L-2-oxothiazolidine-4-carboxylate (OTZ)) in modulating the detoxification pathway of lactating dams and suckling murine pups. In dams, 100 mg/kg b.w./day treatment of each of the vitamin and non-vitamin antioxidants induced a significant increase in the hepatic level of acid soluble sulfhydryl (-SH) compared to the modulating efficiency of OTZ, glutathione and alpha-tocopherol in the kidney tissue. In the liver and kidney tissues of suckling pups OTZ and alpha-tocopherol were effective in modulating the -SH level. A statistically significant increase in the hepatic glutathione-S-transferase (GST) level was observed by OTZ, glutathione and alpha-tocopherol, while only OTZ was effective in the kidney tissue of dams and pups. In the murine system, the modulation of cellular GST/GSH status, specifically by OTZ, alpha-tocopherol and interacting antioxidant pool, may potentially ameliorate the pathophysiology of oxidative stress.

Animals↗
PubMed1997

Modulatory influence of arecoline on the phytic acid-altered hepatic biotransformation system enzymes, sulfhydryl content and lipid peroxidation in a murine system.

The potential of arecoline alkaloid, by direct or translactational exposure, to modify the chemopreventive efficacy of phytic acid, via modulation of hepatic biotransformation system enzymes and antioxidant defence mechanism, was assessed in a murine system. Phytic acid (500 or 1000 mg/kg b.w. per day) induced a statistically significant increase in the hepatic levels of glutathione S-transferase (GST) and sulfhydryl (-SH) in murine females and suckling neonates. The elevated levels of hepatic cytochrome b5 (Cyt. b5), cytochrome P-450 (Cyt. P-450) and the depleted level of malondialdehyde (MDA) were observed in the lactating mice. Arecoline (20 mg/kg b.w. per day) alone did not modulate the hepatic GST and -SH levels although it induced a statistically significant increase in the levels of Cyt. b5, Cyt. P-450 and MDA in the murine system. Phytic acid-modulated hepatic levels of phase II components were depressed whereas phase I enzymes and lipid peroxides were further elevated by arecoline-plus-phytic acid treatment. The implications of direct or translactational modulation in the competing potential pathways of biotransformation system enzymes in the process of chemical carcinogenesis are discussed.

Animals↗
PubMed1997

Genetic variations at the T cell receptor gamma locus in circulating peripheral blood mononuclear cells of clinically categorised leprosy patients.

The allelic polymorphisms at exon 3 and exon 2 of the T cell receptor (TCR) C gamma 2 (TRGC2) gene, generating 18-kb and 5.4-kb HindIII fragments, respectively, were found to be more frequent in multibacillary leprosy patients than in the controls (P < 0.005 and P < 0.001, respectively) when screened with the IDP2.11 probe. The frequencies of heterozygotes for the 18-kb allele and homozygotes for the 5.4-kb allele were found to be significantly higher in the multibacillary patients than in the controls (P < 0.001). Interestingly, the 8.0-kb allele, originating from the triplication of exon 2 of C gamma 2, was observed exclusively in the paucibacillary leprosy patients. Further, when DNA samples were screened with the pH60 probe for the HindIII RFLP at the TCR J gamma 2 (TRGJ2) gene segment, the 2.1-kb allele was again more prevalent in leprosy patients with the multibacillary form of the disease than in the paucibacillary patients and the controls (P < 0.025). The frequency of homozygotes for the 2.1-kb allele was also significantly higher in the multibacillary patients than in the paucibacillary patients (P < 0.010) and the controls (P < 0.025). A significant difference was observed in the frequencies of detectable rearrangements involving the V gamma 7/8 and V gamma 9 gene segments at the gamma locus between circulating peripheral blood mononuclear cells of the multibacillary leprosy patients and the controls. These rearrangements were detected less frequently in the multibacillary patients (P < 0.001 for V gamma 7/8 and P < 0.005 for V gamma 9).

Alleles↗
PubMed1997

Association of polymorphism at COL3A and CTLA4 loci on chromosome 2q31-33 with the clinical phenotype and in-vitro CMI status in healthy and leprosy subjects: a preliminary study.

Two genetic loci, viz. COL3A and CTLA4, located within the chromosome 2q31-33 region in the vicinity of the proposed syntenic site of the mouse "Bcg" locus were genotyped by the polymerase chain reaction in leprosy patients and healthy individuals. All the subjects studied were assessed as in-vitro responders/non-responders to mycobacterial antigens. Simple sequence length polymorphism analysis revealed five (236 to 312 bp) and eight (84 to 120 bp) allelomorphs for COL3A and CTLA4, respectively. Our preliminary analysis showed a significant association between the 250-bp COL3A allelomorph in the homozygous condition and the multibacillary form of leprosy (P < 0.05: relative risk = 5.5). Another allelic (312 bp) variant of COL3A was significantly correlated with non-responsiveness to M. leprae antigens in vitro (P < 0.01). The 104-bp allelomorph of CTLA4 was not observed in any of the 25 cases of leprosy. This absence was statistically significant (P < 0.05) when compared with normal healthy controls and depicted a high relative risk (RR = 25.83). An additional observation of the predominance of a unique 84-bp CTLA4/CTLA4-like allelomorph was observed in the Indian subjects studied.

Abatacept↗