PubMed Health⌕ Search

Biomedical subjects

R C Elkins

Publications and source records attributed to R C Elkins.

At least 19 recordsLinked to original sources
PubMed1999

Ross procedure for ascending aortic replacement.

BACKGROUND: Patients with aortic valve disease and aneurysm or dilatation of the ascending aorta require both aortic valve replacement and treatment of their ascending aortic disease. In children and young adults, the Ross operation is preferred when the aortic valve requires replacement, but the efficacy of extending this operation to include replacement of the ascending aorta or reduction of the dilated aorta has not been tested. METHODS: We reviewed the medical records of 18 (5.9%) patients with aortic valve disease and an ascending aortic aneurysm and 26 (8.5%) patients with dilation of the ascending aorta, subgroups of 307 patients who had a Ross operation between August 1986 and February 1998. We examined operative and midterm results, including recent echocardiographic assessment of autograft valve function and ability of the autograft root and ascending aortic repair or replacement to maintain normal structural integrity. RESULTS: There was one operative death (2%) related to a perioperative stroke. Forty-two of 43 survivors have normal autograft valve function, with trace to mild autograft valve insufficiency, and one patient has moderate insufficiency at the most recent echocardiographic evaluation. None of the patients has dilatation of the autograft root or of the replaced or reduced ascending aorta. CONCLUSIONS: Early results with extension of the Ross operation to include replacement of an ascending aortic aneurysm or vertical aortoplasty for reduction of a dilated ascending aorta are excellent, with autograft valve function equal to that seen in similar patients without ascending aortic disease.

Adolescent↗
PubMed1999

Advantage of autograft and homograft valve replacement for complex aortic valve endocarditis.

BACKGROUND: There are advantages to using homografts and autografts as aortic valve replacements, particularly in patients with infective endocarditis. To better define these advantages, we reviewed our 13-year experience with the surgical management of infective endocarditis involving the aortic valve and root. METHODS: From 1986 through 1998, 81 adults with aortic valve endocarditis underwent valve replacement (AVR). The mean age of the 65 men and 16 women was 44 +/- 14 years. Sixty-three (78%) patients had active endocarditis at the time of operation. Non-native valve endocarditis was present in 29 (36%) patients, in 9 of whom the infection was a recurrence. Aortic valve replacements were performed with 46 homografts (homo-AVR), 25 autografts (Ross-AVR), and 10 prosthetic valves (prosth-AVR). Among Ross-AVR and homo-AVR patients, 11 required mitral valve replacement or repair (homo-Ross DVR). Follow-up was 90% complete within 2 years of the end of the study with a mean of 3.7 +/- 3.4 years. RESULTS: Early mortality was 16% (13 of 81 patients). This was 12% (3 of 25 patients) for Ross-AVR, 17% (8 of 46 patients) for homo-AVR, and 20% (2 of 10 patients) for prosth-AVR. Overall late mortality was 10% (7 of 68 patients) with a valve-related late mortality of 7% (5 of 68 patients). Actuarial survival at 5 years was 88% +/- 9% in Ross-AVR, 69% +/- 11% in homo-AVR, and 29% +/- 22% in prosth-AVR (p = 0.03). Endocarditis recurred in 12.5% (1 of 8 patients) with prosth-AVR and 3% (2 of 60 patients) in homo-Ross AVR. CONCLUSIONS: Valve replacement in the presence of native and prosthetic endocarditis remains a formidable challenge. Autografts and homografts are the preferred replacement aortic valves for these patients even if concomitant mitral valve replacement is required, and risk of valve-related death or recurrent endocarditis is low at medium-term follow-up.

Adult↗
PubMed1999

Cryopreserved homograft valves in the pulmonary position: risk analysis for intermediate-term failure.

OBJECTIVE: The purpose of this study was to examine the durability of cryopreserved homografts used to replace the "pulmonary" valve and to identify factors associated with their late deterioration. METHODS: We reviewed our entire experience (1985-1997) with 331 survivors in whom cryopreserved homograft valves (pulmonary, n = 304; aortic, n = 27) were used to reconstruct the pulmonary outflow tract. Median age was 14 years (range, 2 days-62 years). Operations included Ross operation (n = 259), tetralogy of Fallot (n = 41), truncus arteriosus (n = 14), Rastelli operation (n = 11), and others (n = 6). Median follow-up was 3.8 years (range, 0.2-11.2 years); late echographic follow-up was complete for 97% of patients. Homograft failure was defined as the need for explantation and valve-related death; homograft dysfunction was defined as a pulmonary insufficiency grade 3/4 or greater and a transvalvular gradient of 40 mm Hg or greater. RESULTS: Homograft failure occurred in 9% (30 of 331 patients; Kaplan-Meier); freedom from failure was 82% +/- 4% at 8 years. Homograft dysfunction occurred in 12% (39 of 331 patients), although freedom from dysfunction was 76% +/- 4% at 8 years. For aortic homografts, this was 56% +/- 11%, compared to 80% +/- 4% for pulmonary homografts (P =.003). For patients aged less than 3 years (n = 38), this was 51% +/- 12%, compared with 87% +/- 4% for older patients (P =.0001). By multivariable analysis, younger age of homograft donors, non-Ross operation, and later year of operation were associated with homograft failure; younger age of homograft donors, later year of operation, and use of an aortic homograft were associated with homograft dysfunction. CONCLUSIONS: Homograft valves function satisfactorily in the pulmonary position at mid-term follow-up. The pulmonary homograft valve appears to be more durable than the aortic homograft valve in the pulmonary position.

Adolescent↗
PubMed1998

The Ross operation in children: 10-year experience.

BACKGROUND: The Ross operation, first performed in children in 1968, may be the ideal aortic valve replacement. Technical demands of the operation and two valves at risk have delayed acceptance. A review of our experience to assess midterm and long-term results with the Ross operation is presented. METHODS: The records of 150 consecutive patients, aged 7 days to 21 years (median age, 12 years, 75% less than 15 years) were reviewed. Follow-up was complete within the last 12 months (median, 2.8 years; range, 1 month to 10 years). Echocardiographic assessment was available on 116 (71%) within 1 year of closure and in 136 (91%) within 2 years. RESULTS: Survival was 97.3% at 8 years. Late autograft valve dysfunction required replacement in 2 and reoperation with restitution of autograft function in 6. Freedom from reoperation for autograft dysfunction is 90% +/- 4% at 8 years. Freedom from reoperation for homograft obstruction is 94% +/- 3% at 8 years. Pulmonary homograft dysfunction (gradient > 40 mm Hg) was present in 4 additional patients. Freedom from reoperation on the homograft or a gradient of 40 mm Hg is 89% +/- 4% at 8 years. All patients have a normal, active lifestyle, without anticoagulants for their aortic valve replacement. CONCLUSIONS: The Ross operation is the preferred operative replacement in children requiring aortic valve replacement.

Adolescent↗
PubMed1998

A 26-year experience with surgical management of tetralogy of Fallot: risk analysis for mortality or late reintervention.

BACKGROUND: Over the past decade repair of tetralogy of Fallot (TOF) in infancy has gained favor. It is still uncertain what effect early complete repair will have on survival or late reoperation on the right ventricular outflow tract. METHODS: To assess these outcomes, we reviewed our experience (1971-1997) with 294 patients undergoing operation at one institution. Median follow-up was 10.6 years (range, 0.1 to 26 years), and was complete for 90.2% patients. RESULTS: Primary complete repair was done in 199 patients (68%), and a staged repair in 62 patients (21%). Thirty-three patients had only a palliative procedure. Sixty-eight patients (23.1%) had complex pathologic processes, including pulmonary atresia in 53. Hospital mortality for primary repair was 11.1% (22/199), for staged repair was 17.7% (11/62), and for palliative procedures was 15.5% (16/103 procedures). Since 1990 mortality has been 2.1%, 11.8%, and 0% respectively (p < 0.001), despite younger age at repair (0.6+/-0.1 versus 2.1+/-0.2 years; p < 0.001). Multivariate analysis identified longer period of hypothermic circulatory arrest, pulmonary artery patch angioplasty, earlier year of operation, and closure of the foramen ovale as risk factors for hospital death. For hospital survivors 20-year survival was 98%+/-3% for TOF with pulmonary stenosis and 88%+/-9% for TOF with pulmonary atresia (p=0.09). Reintervention on the right ventricular outflow tract was needed in 14.1% (37/261) patients. Freedom from reintervention on the right ventricular outflow tract at 20 years was 86%+/-4% for TOF with pulmonary stenosis and 43%+/-16% for TOF with pulmonary atresia (p=0.001). For the subgroup TOF with pulmonary stenosis, this was 85%+/-5% after primary repair and 91%+/-8% after staged repair (not significant). At 15-year follow-up, this was 78%+/-10% for patients not older than 1 year at operation compared with 88%+/-4% for older patients (not significant). CONCLUSIONS: Early mortality after primary repair of TOF has significantly improved and late survival is excellent. Primary repair in infancy does not increase risk for reintervention on the right ventricular outflow tract.

Adolescent↗
PubMed1997

Improved results in the management of surgical candidates with lung cancer.

BACKGROUND: Perioperative mortality and morbidity after lung resection for carcinoma are generally reported to be 3% to 6% and 15% to 30%, respectively, and higher in the elderly and those with limited cardiopulmonary reserve. METHODS: To minimize this risk and extend the surgical option to more high-risk patients, we adopted a protocol in 1991 that included preoperative digitalis, subcutaneous heparin and venoocclusive stockings, aggressive perioperative pulmonary toilet, and video-directed limited resections for many patients with limited pulmonary reserve. In October 1996, we reviewed our results with 173 consecutive patients (median age, 60 years; range, 17 to 89 years) undergoing operation for suspected lung carcinoma. Forty-one patients were 70 years old or older, and 70 patients were considered high risk on the basis of advanced age (> or = 70 years), poor cardiac or pulmonary reserve, or serious medical comorbidity. Procedures included pneumonectomy (n = 31), lobectomy (n = 83), bilobectomy (n = 12), and limited resection (n = 45). Two patients had unresectable disease. RESULTS: Hospital mortality was 1.6% (3/173) and morbidity was experienced by 15% (26/173). Among the high-risk subgroup mortality was 4.2% (3/70) and morbidity was 20% (14/70; p < 0.03). For the older patients these values were 4.8% (2/41) and 17.9% (7/41), respectively. CONCLUSIONS: Morbidity and mortality from lung resections may be minimized with the perioperative management strategy outlined above. This would allow more high-risk patients to benefit from surgical resection, and do so with an acceptably low risk.

Adenocarcinoma↗
PubMed1997

Congenital aortic valve disease. Improved survival and quality of life.

OBJECTIVE: The purpose of the study was to assess the effect of recent trends in surgical management, including use of the Ross Operation, on improved survival and quality of life in patients treated surgically for aortic valve (AV) disease at Oklahoma Children's Hospital. BACKGROUND: Surgical treatment of congenital AV disease has proved to be palliative, but newer procedures may be improving outcomes. METHODS: A retrospective review of 301 patients, age 1 day to 26 years (median, 5 years), having a surgical AV procedure or aortic balloon valvuloplasty at Children's Hospital of Oklahoma between 1960 and February 1996, was conducted. Information was collected on all prior and subsequent operations, and follow-up within 1 year was 96% complete. RESULTS: Survival for all patients was 90% +/- 2% at age 10 years and 73% +/- 8% at age 25. By age 5, 52% +/- 4% had required an AV procedure, 89% +/- 3% by age 15. Patient survival was affected adversely by the diagnosis of valvar aortic stenosis, 79% +/- 6% at age 25 compared to 95% +/- 4% for subvalvar aortic stenosis or aortic insufficiency (p = 0.01). The AV morphology did not affect survival, but patients with a bicuspid or unicuspid valve required operative intervention at an earlier age. Survival after autograft replacement of the AV (Ross Operation) was significantly better than for other types of valve replacement (p = 0.0043). Quality of life as assessed by need for reoperation favors the use of the Ross Operation, with freedom from reoperation at 9 years of 87% +/- 7% compared to 55% +/- 5% in all patients after first AV surgery (p = 0.003). CONCLUSIONS: The Ross Operation appears to have a significant advantage in survival and quality of life in children requiring a valve replacement as a first operation or after a prior AV procedure.

Adolescent↗
PubMed1997

Chromosomal localization of a human mucin gene (MUC8) and cloning of the cDNA corresponding to the carboxy terminus.

A partial cDNA (pAM1) encoding a major airway mucin glycoprotein with novel tandem repetitive sequence has recently been cloned (Shankar, V., M. S. Gilmore, R. C. Elkins, and G. P. Sachdev. 1994. Biochem. J. 300:295-298). In this article, we report additional new sequence derived by 3'-rapid amplification of cDNA ends technique. The sequence corresponds to a stop codon, 3'-untranslated region of 458 bp, a polyadenylation signal, and poly A+ tail, and represents the extreme carboxy terminus of MUC8. A plasmid construct (pAM3) in pBluescript was generated by in-frame ligation of pAM1 to the 479-bp 3'UTR of MUC8. A 5'-end 325-bp fragment of this cDNA subcloned into the protein fusion and expression vector pET28b(+) was used to generate fusion protein under the control of T7 promoter. The purified fusion protein as well as synthetic peptide corresponding to the MUC8 repeat sequence (TSCPRPLQEGTPGS) were used to raise polyclonal antibodies in rabbits. The antiserum to the fusion protein and to the synthetic peptide reacted with the deglycosylated major tracheobronchial mucin. Immunohistochemical studies using the above antibodies localized the MUC8 protein product to submucosal glands in human tracheal epithelium. Furthermore, the gene from which this cDNA is derived, was mapped to chromosome 12 using DNA from a panel of human-mouse somatic cell hybrids. Fluorescence in situ hybridization was used to assign the regional localization to 12q24.3. Since the eight known human mucin genes map to other chromosomes, we have named this gene MUC8, in accordance with mucin gene nomenclature.

Amino Acid Sequence↗
PubMed1997

Evaluation of cryopreserved homografts in the right ventricular outflow tract after the Ross procedure: intermediate-term follow up.

BACKGROUND AND AIMS OF THE STUDY: The Ross procedure involves replacing a transplanted pulmonary valve with a cryopreserved homograft in order to re-establish right ventricle-pulmonary artery continuity. This study reviews mid-term results of such surgery in children and young adults. METHODS: Since November 1986, 114 patients have undergone the Ross procedure at the Children's Hospital of Oklahoma using cryopreserved pulmonary homografts (n = 113) and aortic homograft (n = 1) to reconstruct the right ventricular outflow tract. Graft size ranged from 16 to 32 mm. Ninety-three patients (mean age at implant 10.4 years (range: 0.8-22 years) have had complete mean follow up of 3.2 years (range: 5 months to 8.4 years) after surgery. Homograft evaluation included clinical reports and comparison of early post-implant and latest echocardiography. Measurements of homograft valve annulus and peak instantaneous Doppler gradient were compared; quality of valve leaflets, location of obstruction, and the degree of pulmonary regurgitation were assessed. RESULTS: Compared with early postoperative data, mean homograft annulus size decreased by 15% (p < 0.0001); in 88% of patients, the decrease ranged from one to nine millimeter. Peak Doppler gradient increased significantly (from 10 to 17 mmHg, p < 0.0001); 25% of patients developed gradients > 25 mmHg, and four had gradients > 50 mmHg. Significant obstruction developed most often at the supravalvular level or in the homograft conduit itself. This usually occurred within one year of implant, and was associated with calcification and contracture of the homograft wall. Significant pulmonary regurgitation developed in 19 cases (20%), but was more than mild in only three. Leaflet integrity was maintained except in those who developed severe stenosis or regurgitation. Two patients have undergone re-operation for homograft stenosis 2.8 and 5.4 years respectively after the Ross procedure; one has developed recurrent severe stenosis in the homograft four months later. CONCLUSIONS: After the Ross procedure: (i) Pulmonary homografts undergo significant annular reduction in most patients, though this is usually not associated with the development of significant obstruction. (ii) Peak Doppler gradients across the homograft increase in most patients, though only 4% develop more than mild obstruction. (iii) Mild pulmonary regurgitation is common (20%); moderate or severe regurgitation is rare and usually develops in concert with severe stenosis. (iv) Severe homograft valve degeneration usually occurs within one year of implant, and may reflect an immune-mediated response.

Adolescent↗
PubMed1996

Pulmonary autografts in patients with aortic annulus dysplasia.

BACKGROUND: Pulmonary autograft replacement of the aortic valve is indicated in the young, in patients with an active life style, and when anticoagulation is contraindicated. Its use in patients with a dilated aortic annulus or sinotubular junction has historically had a less satisfactory result. METHODS: To extend the advantages of the pulmonary autograft to this group of patients, we performed the Ross operation as a root replacement and "fixed" and narrowed the aortic annulus with external woven Dacron in 12 patients, Teflon felt in 5, and pericardium in 3. Twenty patients, aged 7 to 47 years (median, 27 years), are reported to assess the effectiveness of this operative technique. Preoperative aortic annulus diameter was 23 to 33 mm (13 were >27 mm). RESULTS: There were no operative or late deaths. Early postoperative, echocardiographic evaluation of autograft valve function revealed no significant obstruction, grade 0 aortic insufficiency in 5, trace to 1+ in 12, and 2+ in 2. Late evaluation of 1 to 4 years is available in 12 patients and has shown no increase in autograft insufficiency. CONCLUSIONS: This experience suggests that operative fixation of the aortic annulus with an external Dacron cuff is effective and is recommended in patients with an aortic annulus that is significantly greater than normal for their body size.

Adolescent↗
PubMed1996

Pulmonary autograft reoperation: incidence and management.

BACKGROUND: Pulmonary autograft replacement of the aortic valve is accepted in the young, those with an active life style, and those who are not candidates for anticoagulation. However, concern remains about autograft or homograft valve failure. METHODS: One hundred ninety-five operative survivors of the Ross operation (August 1986 through December 1995) were reviewed for operative pathology and factors associated with reoperation or valve dysfunction. RESULTS: Actuarial freedom from reoperation (autograft or homograft) is 89% +/- 3% at 5 years, 92% +/- 3% for the autograft alone. Early autograft valve failures (< 6 months) were due to technical error in 2 patients and persistent endocarditis in 1. Late autograft valve failure (1 to 6.2 years) was due to aortic annulus dilatation in 5 patients, bacterial endocarditis in 1, and valve degeneration in 2. Six autograft valves were replaced and five were repaired. Five patients required reoperation for pulmonary homograft stenosis (1 to 5.4 years) involving obstruction of the conduit distal to the pulmonary valve. CONCLUSIONS: Pulmonary autograft replacement of the aortic valve has a low incidence of reoperation for autograft dysfunction or homograft obstruction. Autograft dysfunction can be corrected by autograft repair in patients with central insufficiency and aortic annular dilatation.

Actuarial Analysis↗
PubMed1996

The Ross operation: applications to children.

The Ross operation is the operation of choice for children requiring an aortic valve replacement. It is associated with a low surgical mortality and late morbidity and does not require anticoagulation. It allows a growing child to have a near-normal lifestyle with a limited risk of reoperation for autograft valve or homograft valve failure.

Adolescent↗
PubMed1995

Associated atrial septal defects increase perioperative morbidity after ventricular septal defect repair in infancy.

Although closure of ventricular septal defects (VSDs) is currently associated with a relatively low risk, infants with associated atrial septal defects (ASDs) seem to have a higher perioperative morbidity. To clarify this impression, we reviewed our entire experience (since 1977) with closure of simple VSDs in 163 infants (age, < or = 12 months). Of these, 57 had significant ASDs (ASD-VSD subgroup). Hospital mortality was 3.7% (6/163) overall and 1.4% (2/145) since 1980. Actuarial survival at 10 years was 92% +/- 5%. Significant morbidity occurred in 15.5% (16/103) of the VSD subgroup versus 48.1% (26/54) of the ASD-VSD subgroup (p < or = 0.001). Multivariate analysis identified the presence of multiple VSDs and early date of operation as risk factors for hospital death, and younger age, an associated ASD, the size of the VSD, and use of hypothermic circulatory arrest as risk factors for significant perioperative morbidity. Compared with the VSD subgroup, the ASD-VSD subgroup had a higher hospital mortality (5.3% [3/57] versus 2.8% [3/106]), were younger (5.1 +/- 2.9 versus 7.2 +/- 2.9 months; p = 0.001), had a higher preoperative pulmonary artery pressure (70.2 +/- 19.0 versus 62.7 +/- 21.8 mm Hg; p = 0.08), needed more inotropic support (12.3% versus 3.7%; p = 0.07), needed more prolonged ventilation (3.3 versus 1.8 days; p = 0.02), and had longer postoperative hospital stays (11 versus 8 days; p = 0.005).(ABSTRACT TRUNCATED AT 250 WORDS)

Age Factors↗
PubMed1995

Modified hemi-Fontan operation: an alternative definitive palliation for high-risk patients.

BACKGROUND: We conceptualized that by adding small amounts of prograde pulmonary blood flow to the hemi-Fontan operation, or bidirectional Glenn procedure, this modified hemi-Fontan operation could be safely done at an early age, with better oxygenation, and with less potential for pulmonary arteriovenous fistulae. METHODS: Since April 1992 the hemi-Fontan operation was modified by adding some prograde flow through the native pulmonary artery in 10 high-risk infants, either by leaving the critical subpulmonary stenosis untreated (n = 6) or by tightening a previously placed pulmonary artery band (n = 4). All other sources of pulmonary blood flow were interrupted. Patients were 4 to 23 months old (3.8 to 10.3 kg). Diagnoses included isolated dextrocardia with single ventricle (3) and polysplenia syndrome (2). Cardiopulmonary bypass was needed in 5 patients. RESULTS: There were no hospital deaths. Mean postoperative intensive care unit stay was 2 days, and 9 of 10 patients were discharged within 7 days of operation. One 4-month-old infant with Down's syndrome survived postoperative takedown of the hemi-Fontan repair after pneumonia and caval thrombosis developed. Eight patients are currently asymptomatic receiving minimal modification, and oxygen saturations range from 84% to 93%. CONCLUSIONS: Adding small volumes of prograde pulmonary blood flow to the hemi-Fontan operation is safe, provides improved oxygenation, may encourage growth of central pulmonary arteries, and represent an alternative definitive palliation for high-risk Fontan candidates.

Child, Preschool↗
PubMed1994

A novel human airway mucin cDNA encodes a protein with unique tandem-repeat organization.

Highly specific affinity-purified polyclonal antibodies against deglycosylated human tracheobronchial mucin was used to select immunoreactive clones from a Uni-ZAP cDNA expression library prepared from normal human tracheal mRNA. The largest of three positive clones, designated pAM1, which reacted strongly with the polyclonal antibodies, was further characterized. Sequence analyses revealed a partial 941 bp cDNA that encoded a 313-amino-acid polypeptide. Bases 3-892 consisted of imperfect 41-nucleotide tandem repeats (CCAGGAGGGGACACCGGGTTCACGAGCTGCCCACGCCCTCT) that encoded a unique polypeptide with two types of consensus repeats, TSCPRPLQEGTRV and TSCPRPLQEGTPGSRAAHALSRRGHRVHELPTSSPGGDTGF. The overall composition of the deduced amino acid sequence matched that expected for a mucin protein core and is rich in serine, threonine, proline, glycine and alanine (approximately 51%). Northern blots probed with the mucin cDNA exhibited intense polydisperse hybridization bands with RNA isolated from normal human trachea and cystic-fibrosis bronchus. The data indicate that mucin encoded by clone pAM1 represents a unique type of peptide organization which has not been described in mucin cDNAs reported thus far.

Amino Acid Sequence↗