PubMed Health⌕ Search

Biomedical subjects

R Dhar

Publications and source records attributed to R Dhar.

At least 37 records · Page 2Linked to original sources

Advancement through mitosis requires rae1 gene function in fission yeast.

Growth of the rae1-1 mutant of Schizosaccharomyces pombe at restrictive temperature results in accumulation of poly(A)+ RNA in the nucleus and a cell cycle arrest at the G2/M boundary. We demonstrate here that rae1 function is required for a process other than mRNA export which is essential for advancement through mitosis. Cells lacking rae1 function arrest with elevated Cdc2p kinase levels at a step before the formation of a mitotic spindle and without separation of the spindle pole bodies. Rae1p was localized to the nuclear periphery, consistent with a role in nucleocytoplasmic trafficking, which could include protein import. We propose a model where rae1 functions in cell cycle progression through trafficking of proteins required for mitosis.

CDC2 Protein Kinase↗

Npp106p, a Schizosaccharomyces pombe nucleoporin similar to Saccharomyces cerevisiae Nic96p, functionally interacts with Rae1p in mRNA export.

To identify components of the mRNA export machinery in Schizosaccharomyces pombe, a screen was developed to identify mutations that were synthetically lethal with the conditional mRNA export allele rae1-167. Mutations defining three complementation groups were isolated, and here we report the characterization of npp106 (for nuclear pore protein of 106 kDa). This gene encodes a predicted protein that has significant similarity to the Nic96p nucleoporin of Saccharomyces cerevisiae. Consistent with Npp106p being a nucleoporin, a functional green fluorescent protein (GFP)-tagged Npp106p localized to the nuclear periphery. In contrast to NIC96, the npp106 gene is not essential. Moreover, a delta npp106 mutant did not show cytoplasmic mislocalization of a simian virus 40 nuclear localization signal-GFP-LacZ reporter protein, and a fraction of cells had accumulation of poly(A)+ RNA in the nucleus. A consequence of the synthetic lethality between rae1-167 and npp106-1 was the accumulation of poly(A)+ RNA in the nucleus when cells were grown under synthetic lethal conditions. In addition to npp106-1, which is a nonsense mutation that truncates the protein at amino acid 292, the delta npp106 mutation was synthetically lethal with rae1-167, suggesting that the synthetic lethality is a consequence of the loss of a function of npp106. We further demonstrate that a region between amino acids 74 and 348 of Npp106p is required for complementation of the synthetic lethality. These results uncover a potential direct or indirect involvement of Npp106p in mRNA export.

Amino Acid Sequence↗

Effect of volatiles from neem and other natural products on gonotrophic cycle and oviposition of Anopheles stephensi and An. culicifacies (Diptera: Culicidae).

The gonotrophic cycle of female Anopheles was impaired by exposure to volatiles of neem, (Azadirachta indica), reetha, (Sapindus mukorossi), and garlic, (Allium sativum), but not to castor seeds and cotton seed oil. A brief exposure to contact or volatile extracts from neem suppressed rather than inhibited oviposition. Complete inhibition of oviposition was observed by exposure of mosquitoes to neem oil and 1 fraction containing volatile components. Vitellogenesis was impaired irreversably by long-term exposure to neem odor and some extracts. The effect of volatiles on oviposition seems to be regulated by absorption through the cuticle, although passage through the spiracles could not be excluded.

Animals↗

A mutation in the Schizosaccharomyces pombe rae1 gene causes defects in poly(A)+ RNA export and in the cytoskeleton.

A collection of fission yeast Schizosaccharomyces pombe conditional mutants was screened for defective nucleocytoplasmic transport of poly(A)+ RNA by fluorescence in situ hybridization. We identified a temperature-sensitive mutant that accumulated poly(A)+ RNA in the nucleus and have named it rae1-1, for ribonucleic acid export. All rae1-1 cells exhibit the defect in poly(A)+ RNA export within 30 min following a shift to the non-permissive temperature. In addition, in the rae1-1 mutant, actin and tubulin become disorganized, and cells undergo an irreversible cycle arrest. Results from experiments in which rae1-1 cells were arrested in various phases of the cell division cycle and then shifted to nonpermissive temperature suggest that cells are particularly vulnerable to loss of rae1 function during G2/M. However, the inability to export RNA from the nucleus to the cytoplasm was not limited to a particular phase of the cell division cycle. The rae1 gene was isolated by complementation and encodes a predicted protein of 352 amino acids with four beta-transducin/WD40 repeats.

Actins↗

Effect of single-base substitutions in the central domain of virus-associated RNA I on its function.

Adenoviruses use virus-associated RNA I (VAI RNA) to counteract the cellular antiviral response mediated by the interferon-induced, double-stranded-RNA-activated protein kinase PKR. VAI RNA is a highly structured small RNA which consists of two long duplex regions connected at the center by a complex, short stem-loop. This short stem-loop and the adjacent base-paired regions, referred to as the central domain, bind to PKR and inactivate it. Currently it is not known whether binding of VAI RNA to PKR is dependent solely on the secondary (and tertiary) structure of the central domain or whether nucleotide sequences in the central domain are also critical for this interaction. To address this question, 54 VAI mutants with single-base substitution mutations in the central domain of the RNA were constructed, and their capacities to inhibit the autophosphoryation of PKR in vitro were determined. It was found that although about half of the mutants inhibited PKR activity as efficiently as the wild type, a significant number of mutants lost the inhibitory activity substantially, without a perceptible change in their secondary structures. These results indicate that, in addition to secondary structure, at least some nucleotides in the central domain may be critical for the efficient function of VAI RNA.

Adenoviruses, Human↗

Small bowel obstruction in pregnancy.

OBJECTIVES: Small bowel obstruction (SBO) is an unusual complication of pregnancy. Our objective was to review our experience at two urban hospitals. METHODS: To this end, we conducted a retrospective chart review of all pregnant patients with a discharge diagnosis of intestinal obstruction at Grace Hospital, Detroit, MI (January 1, 1972 to January 1, 1992) and Hutzel Hospital, Detroit, MI (January 1, 1977 to January 1, 1992). RESULTS: During the study period, nine cases of SBO were identified and 150,386 deliveries occurred (one case per 16,709 deliveries). Patients' ages ranged from 16 to 37 yr. There were six primiparas. Cases of SBO by trimester: four in second, four in third, and one in puerperium. Previous abdominal surgery was documented in eight patients. Duration of symptoms before admission ranged from 3 h to 3 days. Primary symptoms were abdominal pain (89%), vomiting (89%), and obstipation (80%). At admission, only one patient was febrile, and four had hypoactive bowel sounds. Abdominal x-rays were compatible with SBO in seven patients. Ultrasound identified SBO in one of four cases. Patients were hospitalized 6 h to 23 days before surgery. The admission diagnosis was incorrect in four cases. One patient was treated conservatively and, at 36 wk, vaginally delivered a healthy infant. The eight surgical patients had lysis of adhesions, with one requiring resection of gangrenous small bowel. There were three fetal deaths (at 22, 24, and 30 wk of gestation). No maternal deaths occurred. CONCLUSION: SBO is a rare, but often catastrophic, complication during pregnancy and the puerperium. Clinical suspicion is critical and should be increased in a patient with an abdominal scar. If suspected, prompt abdominal x-rays, ultrasound, and surgical consultation are warranted.

Adolescent↗

In vitro analysis of virus-associated RNA I (VAI RNA): inhibition of the double-stranded RNA-activated protein kinase PKR by VAI RNA mutants correlates with the in vivo phenotype and the structural integrity of the central domain.

Adenoviruses use the virus-encoded virus-associated RNA (VAI RNA) as a defense against cellular antiviral response by blocking the activation of the interferon-induced, double-stranded RNA-activated protein kinase PKR. The structure of VAI RNA consists of two long, imperfectly base-paired duplex regions connected by a complex short stem-loop at the center, referred to as the central domain. By using a series of adenovirus mutants with linker-scan mutations in the VAI RNA gene, we recently showed that the critical elements required for function in the VAI RNA molecule are in the central domain and that these same elements of the central domain are also involved in binding to PKR. In virus-infected cells, VAI RNA interacts with latent kinase, which is bound to ribosomes; this interaction takes place in a complex milieu. To more fully understand the relationship between structure and function and to determine whether the in vivo phenotype of these mutants can be reproduced in vitro, we have now analyzed these mutant VAI alleles for their ability to block the activation of a partially purified PKR from HeLa cells. We have also derived the structure of these mutants experimentally and correlated the structure with function. Without exception, when the structure of the short stem-loop of the central domain was perturbed, the mutants failed to inhibit PKR. Structural disruptions elsewhere in the central domain or in the long duplex regions of the molecule were not deleterious for in vitro function. Thus, these results support our previous findings and underscore the importance of the elements present in the central domain of the VAI RNA for its function. Our results also suggest that the interaction between PKR and VAI RNA involves a precise secondary (and tertiary) structure in the central domain. It has been suggested that VAI RNA does not activate PKR in virus-infected cells because of mismatches in the imperfectly base-paired long duplex regions. We constructed mutant VAI genes in which the imperfectly base-paired duplex regions were converted to perfectly base-paired regions and assayed in vitro for the activation of PKR. As with the wild-type VAI RNA, these mutants failed to activate PKR in vitro, while they were able to block the activation of PKR better than did the wild type. These results suggest that the failure of VAI RNA to activate PKR is not the result of mismatches in the long duplex regions.(ABSTRACT TRUNCATED AT 400 WORDS)

Adenoviruses, Human↗

E2F site activates transcription in fission yeast Schizosaccharomyces pombe and binds to a 30-kDa transcription factor.

The mammalian transcription factor E2F binds to several cellular proteins including Rb, p107, cyclin A, cyclin E, and p33cdk2 protein kinase in a stage-specific manner during cell cycle. Its recognition sequence, TTTCGCGC, is present in two of the human adenovirus early promoters and in several promoters of cellular genes whose products are implicated in the control of cell proliferation. These observations suggest that E2F may play an important role in cell-cycle regulation and prompted us to ask whether E2F-like activities are present in yeast. We found that the E2F motif can function as an activating sequence in Schizosaccharomyces pombe when cloned upstream of a reporter gene. Consistent with this, the expression of adenovirus E2 promoter in S. pombe was dependent on both E2F motifs of this promoter. A protein, spE2F, that binds to the E2F site was partially purified from S. pombe using DNA-affinity chromatography. The binding specificity of this protein was compared to that of human E2F using a number of mutant E2F sites as competitors. These studies showed that spE2F recognizes a sequence closely related to the E2F site. Ultraviolet cross-linking and Southwestern blot studies indicated that the molecular size of spE2F is 30 kDa. Previous studies have shown that a cis-acting element, ACGCGTNA, also called MluI cell cycle box, or MCB, is critical for the regulated expression of cell cycle related genes both in fission and budding yeast. In S. pombe, the cdc10 gene product binds to this element and controls the cell cycle related genes. Electrophoretic mobility shift assays and molecular size determination studies indicated that spE2F is different from that encoded by cdc10. Thus, our studies suggest that spE2F is a novel transcription factor. We discuss these results in light of recent observations about the periodically expressed genes involved in the cell cycle progression in yeast.

Adenoviruses, Human↗

Activation of a dual adenovirus promoter containing nonconsensus TATA motifs in Schizosaccharomyces pombe: role of TATA sequences in the efficiency of transcription.

The role of TATA elements in the expression of a mammalian promoter was investigated in the fission yeast Schizosaccharomyces pombe, by studying the human adenovirus E2-early promoter. This is a unique dual promoter with two nonconsensus TATA elements directing transcription from two cap sites, +1 and -26. A sequence TTAAGA provides the TATA box function for the +1 promoter, whereas a sequence TAAATT, with a closer resemblance to the consensus (TATAA/TA) provides this function for the -26 promoter. Yet, in human cells, the +1 promoter is transcribed about 20 fold more efficiently than the -26 promoter. We found that both promoters are transcribed faithfully in S. pombe with start sites identical or close to those found in human cells. Surprisingly, the relative ratio of expression for the +1 and -26 promoters was exactly reversed in S. pombe cells. This reversal appeared to be due to the relatively weak binding of S. pombe TATA binding protein to the TTAAGA motif, rather than to its rate of dissociation. Furthermore, we show that in S. pombe, promoter expression correlates well with the nucleotide sequence of the TATA element rather than the context in which it is placed. By contrast, it is the context of the TATA element, rather than its nucleotide sequence that appears to be critical for promoter expression in human cells. Our data suggest the existence of one or more additional factors in human cells that permit the utilization of nonconsensus TATA elements. S. pombe appears to lack these factors.

Adenoviruses, Human↗

Transcriptional activity of the human immunodeficiency virus-1 LTR promoter in fission yeast Schizosaccharomyces pombe.

We have analyzed the transcriptional activity of the human immunodeficiency virus type I (HIV-1) LTR promoter in the fission yeast Schizosaccharomyces pombe (S.pombe). The ability of a series of 5'-deleted forms of the HIV-1 LTR promoter to direct transcription of the chloramphenicol acetyltransferase reporter gene was studied. We found that the HIV-1 promoter is functional in S.pombe and that deletion of sequences upstream of the NF-kB binding site previously identified to contain the negative regulatory element (NRE) in mammalian cells, resulted in about thirty-fold increase in transcriptional activity. Sequences in the HIV-1 promoter that bind NF-kB were found to be essential for transcriptional activation in S.pombe. In mammalian cells, transactivation of the HIV-1 LTR requires TAR sequences and the viral Tat protein. In fission yeast, Tat failed to transactivate the HIV-1 LTR, suggesting that S.pombe may lack a cellular factor(s) required for the Tat transactivation process.

Base Sequence↗

The BPV-1 E5 oncoprotein expressed in Schizosaccharomyces pombe exhibits normal biochemical properties and binds to the endogenous 16-kDa component of the vacuolar proton-ATPase.

The 44-amino-acid E5 oncoprotein of bovine papillomavirus type 1 transforms immortalized murine fibroblast cell lines. This highly hydrophobic protein forms homodimers, localizes to intracellular membrane compartments (including the Golgi apparatus), and forms a complex with the 16-kDa membrane-embedded constituent (16k) of the vacuolar proton-ATPase. To develop a system for the genetic and biochemical analysis of the E5/16k interaction, the E5 gene was cloned into a new vector which was designed for expression in the fission yeast Schizosaccharomyces pombe. The E5 protein synthesized in this system dimerized normally and bound to endogenous and overexpressed S. pombe 16k protein. Comparison of the S. pombe and mammalian 16k proteins showed strong conservation in carboxyl-terminal amino acids but greater variation in the amino-terminal sequences, suggesting that E5 was interacting with the 16k carboxyl domains. Finally, a new protein epitope tag is described which permitted for the first time the coprecipitation of E5 with antibodies directed against the 16k protein.

Amino Acid Sequence↗

A genomic sequence of the Schizosaccharomyces pombe 16 kDa vacuolar H(+)-ATPase.

We have isolated the gene encoding the 16 kDa vacuolar H(+)-ATPase from Schizosaccharomyces pombe. On the basis of RNA splicing signals and amino acid sequence homology with other 16 kDa H(+)-ATPases, the genomic DNA sequence indicated the 16 kDa protein is encoded by five exons. The C-terminal 50 amino acids has more than 90% homology with vacuolar H(+)-ATPases of mammalian cells.

Amino Acid Sequence↗

Antibiotic susceptibility patterns of selected bacterial isolates in a general hospital in Kuwait.

During a 7-month period beginning February 1989 a total of 3387 bacteria were isolated aerobically from clinical materials at Al-Adan Hospital laboratory. Their susceptibilities to 14 commonly used antibiotics were analysed. Escherichia coli was the most frequently isolated organism among all Gram-negative bacilli. In general, members belonging to Enterobacteriaceae presented higher resistance to ampicillin, trimethoprim-sulphamethoxazole, and cephalothin, the exception being Salmonella spp. Of all the aerobic Gram-positive cocci, Staphylococcus aureus was the most common isolate and showed excellent susceptibility to methicillin (96%) but high resistance to penicillin (94%). We compared our data with susceptibility profiles of 1678 strains isolated in Mubarak Al-Kabeer Hospital during a 4-month period in 1984. This retrospective comparative study in the two hospitals presented some differences, the reasons for which are discussed in this paper.

Anti-Bacterial Agents↗

Tat-regulated production of multimerized TAR RNA inhibits HIV-1 gene expression.

Transcriptional activation of gene expression directed by the long terminal repeat (LTR) of the human immunodeficiency virus type 1 (HIV-1) requires both the Tat activation response element (TAR) and the Tat protein. Mutants lacking a functional tat gene are not able to replicate. An approach we have used to suppress HIV-1 gene expression is based on the controlled overexpression of multimerized TAR sequences, which results in the sequestration of one or more components of the Tat response. Since Tat has no known cellular analog, a modified HIV-1 LTR, which is highly induced by the presence of Tat, was used to promote the expression of the multimerized TAR (poly-TAR) specifically in the presence of Tat. Cotransfection of an HIV-1 LTR-controlled poly-TAR plasmid with LTR-Tat and LTR-CAT plasmids inhibited the level of the reporter gene activity (CAT) as much as 97%. The downregulation of HIV-1 gene expression observed was dependent on the quantity of transfected poly-TAR as well as the number of tandem TAR repeats expressed per unit transcript. Similar constructs lacking either LTR upstream sequences or the TAR sequence had no significant effect, suggesting that the competitive effect was mediated at the RNA level and that it was the nascent RNA, rather than DNA, that was recognized by the Tat protein. Tat-regulated production of the poly-TAR transcript provides a means for dissecting the mechanism of Tat-mediated trans-activation of the HIV-1 LTR. The ability to regulate a viral inhibitory gene so that it is expressed only when needed should prove useful in devising an antiviral strategy through gene therapy.

Base Sequence↗

Transcriptional regulatory elements of the RAS2 gene of Saccharomyces cerevisiae.

We have analyzed a series of 5' deletions of the RAS2 gene to investigate its complex transcriptional regulation in the yeast Saccharomyces cerevisiae. Two positive transcriptional regulatory elements were identified. Element A regulates two of the three clusters of RAS2 transcripts. This element is capable of activating a heterologous promoter and contains two copies of the sequence CCTCGCCCC. Although one copy is sufficient for partial transcriptional activation, both copies are required for maximal RAS2 induction. Deletion of one copy resulted in a reduced level of RAS2 mRNA, selective loss of cluster II transcripts and reduced ability to activate the heterologous CYC1 promoter. Each of the 9 bp C rich repeats of element A is part of a sequence with extensive homology to a transcriptional regulatory element upstream of the human epidermal growth factor receptor (EGFR) gene. Element B contains a tandem duplication of a 21 nucleotide sequence TACATATATATATATCTTAG and activates cluster I RAS2 transcripts in the absence of Element A. The physiological role of these deletions was determined by assaying their ability to support growth on a nonfermentable carbon source. RAS2 promoter deletions containing either element A or B were able to overcome this growth defect characteristic of ras2 mutants cells. Deletion of both elements resulted in an insufficient amount of RAS2 protein for growth on a non-fermentable carbon source.

Base Sequence↗

Expression of human chromosomal proteins HMG-14 and HMG-17 in Saccharomyces cerevisiae.

The cDNAs coding for human chromosomal proteins HMG-14 and HMG-17 were cloned into yeast expression vector pBM150, under the control of the Gal10 promoter. Northern analysis of transformed yeast cells revealed that both cDNAs were efficiently transcribed. Western analysis indicated that the mRNAs were translated into authentic proteins. Expression of human HMG proteins in yeast cell did not produce detectable phenotypic changes, as measured by the growth rate of the yeast cells under a variety of conditions. The antibiotic resistance of the transfected cells was similar to that of control cells, suggesting that the presence of HMG did not affect the expression of actively transcribed genes. However, examination of the protein profile on two-dimensional polyacrylamide gel electrophoresis revealed differences between control and HMG-transfected cells.

Blotting, Northern↗

Persistence of gastric ulcers caused by plain aspirin or nonsteroidal antiinflammatory agents in patients treated with a combination of cimetidine, antacids, and enteric-coated aspirin.

Twenty-three patients chronically ingesting plain aspirin or nonsteroidal antiinflammatory drugs, who had endoscopically proven solitary or multiple gastric ulcers, were treated for eight weeks with cimetidine and antacids. Plain aspirin and nonsteroidal antiinflammatory drugs were discontinued in all patients. Seven patients received enteric-coated aspirin throughout the treatment phase and continuously for the entire study period (2.5-12 months). The remainder of patients (N = 16) did not receive enteric-coated aspirin. An endoscopy was performed to assess ulcer healing. None of seven patients receiving enteric-coated aspirin had complete healing of their ulcer(s) while 15 of 16 patients not receiving enteric-coated aspirin demonstrated complete healing of their ulcer(s) (P less than 0.001). An eight-week course of cimetidine and antacids is ineffective in completely healing gastric ulcers caused by plain aspirin or nonsteroidal antiinflammatory drugs while enteric-coated aspirin is continued.

Antacids↗

Identification of covalently bound fatty acids on acylated proteins immobilized on nitrocellulose paper.

A general method for identification of fatty acids covalently bound to acylated proteins following their electrophoretic transfer onto nitrocellulose paper is described. As demonstrated for [3H]palmitoylated RAS1 protein of Saccharomyces cerevisiae and the acylated acyl carrier protein of Spirodela oligorrhiza, this procedure alleviates the need for elution of proteins from polyacrylamide gel slices. Fatty acid ligands of such proteins are hydrolyzed directly from their immobilized state on the nitrocellulose paper, then derivatized with p-nitrophenacyl bromide, and finally resolved by reversed-phase high-performance liquid chromatography. The amount of acylated protein required for identification of acyl groups is minimized compared to that required for more conventional approaches by coupling a radioactive flow detector with the HPLC system.

Acylation↗