PubMed Health⌕ Search

Biomedical subjects

R E Lockard

Publications and source records attributed to R E Lockard.

At least 19 recordsLinked to original sources
PubMed1988

Characterization of mouse reticulocyte free globin mRNP.

Globin messenger ribonucleoprotein particles (free and polysomal) from mouse reticulocyte lysates were characterized for their mRNA composition, translational activity as well as the proteins in direct contact with them. In contrast to the homogeneous single-peak distribution of rabbit and duck reticulocyte free mRNPs, mouse free mRNP particles were heterogeneously dispersed on the sucrose density gradient into two major domains called region I and region II. Region I appeared enriched with alpha-globin mRNP and region II with beta-globin mRNP. mRNP from both regions was translationally active. Examination of lysates prepared from beta-thalassemic mice revealed a reduction of translatable beta minor mRNP within region I, supporting the hypothesis of a compensatory recruitment of beta minor free mRNP into polysomes in beta-thalassemic mice.

Animals↗
PubMed1988

Chemical probing of adenine residues within the secondary structure of rabbit 18S ribosomal RNA.

The location of unpaired adenine residues within the secondary structure of rabbit 18S ribosomal RNA was determined by chemical probing. Naked 18S rRNA was first prepared by digestion of purified 40S subunits with matrix-bound proteinase K in sodium dodecyl sulfate, thereby omitting the use of nucleic acid denaturants. Adenines within naked 18S rRNA were chemically probed by using either diethyl pyrocarbonate or dimethyl sulfate, which specifically react with unpaired nucleotides [Peattie, D. A., & Gilbert, W. (1980) Proc. Natl. Acad. Sci. U.S.A. 77, 4679-4682]. Adenine modification sites were identified by polyacrylamide sequencing gel electrophoresis either upon aniline-induced strand scission of 32P-end-labeled intact and fragmented rRNA or by primer extension using sequence-specific DNA oligomers with reverse transcriptase. The data indicate good agreement between the general pattern of adenine reactivity and the location of unpaired regions in 18S rRNA determined by comparative sequence analysis [Chan, Y.-L., Gutell, R., Noller, H. F., & Wool, I. G. (1984) J. Biol. Chem. 259, 224-230]. The overall reactivity of adenine residues toward single-strand-specific chemical probes was, also, similar for both rabbit and Escherichia coli small rRNA. The number of strongly reactive adenines appearing within phylogenetically determined helical segments, however, was greater in rabbit 18S rRNA than for E. coli 16S rRNA. Some of these adenines were found clustered in specific helices. Such differences suggest a greater irregularity of many of the helical elements within mammalian 18S rRNA, as compared with prokaryotic 16S rRNA. These helical irregularities could be important for protein association and also may represent biologically relevant flexible regions of the molecule.

Adenine↗
PubMed1987

Identification of the proteins in direct contact with duck globin mRNA.

Proteins in direct contact with translationally active and repressed duck globin mRNA were determined by irradiating blood or lysates with ultraviolet light. Cross-linked proteins from polyribosomes and free mRNP particles were 14C-labeled by reductive methylation and identified on SDS-polyacrylamide gels upon autoradiography. Results indicate that ten cross-linked proteins are common to both polysomal and free mRNP, however, a 44 kDa protein appears to be specific for repressed mRNP particles. Furthermore, the notable lack of cross-linked proteins in the 20-30 kDa range in free mRNP supports the view that the characteristic low molecular mass 'prosomal' proteins, previously found associated with translationally repressed duck globin free mRNP [(1984) EMBO J. 3, 29-34], do not interact directly with the mRNA molecule.

Animals↗
PubMed1986

Secondary structure model for mouse beta Maj globin mRNA derived from enzymatic digestion data, comparative sequence and computer analysis.

A model for the secondary structure of mouse beta Maj globin messenger RNA is presented based on enzymatic digestion data, comparative sequence and computer analysis. Using 5'-32P-end-labeled beta globin mRNA as a substrate, single-stranded regions were determined with S1 and T1 nucleases and double-stranded regions with V1 ribonuclease from cobra venom. The structure data obtained for ca. 75% of the molecule was introduced into a computer algorithm which predicts secondary structures of minimum free energy consistent with the enzymatic data. Two prominent base paired regions independently derived by phylogenetic analysis were also present in the computer generated structure lending support for the model. An interesting feature of the model is the presence of long-range base pairing interactions which permit the beta globin mRNA to fold back on itself, thereby bringing the 5'- and 3'-noncoding regions within close proximity. This feature is consistent with data from other laboratories suggesting an interaction of the 5'- and 3'-domains in the mammalian globin mRNAs.

Animals↗
PubMed1984

Primary structure of rabbit 18S ribosomal RNA determined by direct RNA sequence analysis.

The primary structure of rabbit 18S ribosomal RNA was determined by nucleotide sequence analysis of the RNA directly. The rabbit rRNA was specifically cleaved with T1 ribonuclease, as well as with E. coli RNase H using a Pst 1 DNA linker to generate a specific set of overlapping fragments spanning the entire length of the molecule. Both intact and fragmented 18S rRNA were end-labeled with [32P], base-specifically cleaved enzymatically and chemically and nucleotide sequences determined from long polyacrylamide sequencing gels run in formamide. This approach permitted the detection of both cistron heterogeneities and modified bases. Specific nucleotide sequences within E. coli 16S rRNA previously implicated in polyribosome function, tRNA binding, and subunit association are also conserved within the rabbit 18S rRNA. This conservation suggests the likelihood that these regions have similar functions within the eukaryotic 40S subunit.

Animals↗
PubMed1984

Mapping of psoralen cross-linked nucleotides in RNA.

A method is described for using the cross-linking reagent 4'-(hydroxy-methyl)-4,5',8-trimethylpsoralen (HMT) to map base paired regions and higher-order structure within RNA molecules. Applying this method to yeast tRNAPhe, we have specifically identified cross-links within the acceptor stem between U6 X U68, in the D-stem between C11 X C25, and in the T psi-stem between U50 X C63 and U52 X C63. We have also identified a unique cross-link between U8 X C48 which are trans pyrimidines in the core region due to tertiary interactions between U8:A14 and C48:G15. The precise point of cross-linking was deduced in every case by using purine-specific U2 ribonuclease along with cytidine-specific CL3 ribonuclease which will anomalously cleave after photoreversed pyrimidines. The ability to map the precise point of cross-linking should prove invaluable in identifying nucleotides in close proximity within the tertiary structure of other RNA molecules.

Base Composition↗
PubMed1982

Nucleotide sequence of the 5'- and 3'- domains for rabbit 18S ribosomal RNA.

By direct RNA sequence analysis we have determined the primary structures of both the 5' and 3' domains for rabbit 18S ribosomal RNA. Purified 18S rRNA was labeled in vitro at either its 5' or 3' terminus with 32P, base-specifically fragmented enzymatically and chemically, and the resulting fragments electrophoretically fractionated by size in adjacent lanes of 140 cm long polyacrylamide sequencing gels run in 90% formamide. A phylogenetic comparison of both the mammalian 5' proximal 400 residues and the 3' distal 301 nucleotides with the previously determined yeast and Xenopus laevis 18S rRNA sequence shows extensive conservation interspersed with tracts having little homology. Clusters of G + C rich sequences are present within the mammalian 5' domain which are entirely absent in both the Xenopus laevis and yeast 18S rRNAs. Most base differences and insertions within the mammalian 18S rRNA when compared with yeast or Xenopus rRNA result in an increase in the G + C content of these regions. We have found nucleotide sequence analysis of the ribosomal RNA directly permits detection of both cistron heterogeneities and mapping of many of the modified bases.

Animals↗
PubMed1981

Mapping tRNA structure in solution using double-strand-specific ribonuclease V1 from cobra venom.

A method for mapping all base-paired stems in both elongation and initiator tRNAs is described using double-stranded-specific ribonuclease V1 from the venom of the cobra Naja naja oxiana. 32p-end-labeled RNA is first partially digested with double-strand-specific V1 nuclease under near physiological conditions, and the resultant fragments are than electrophoretically fractionated by size in adjacent lanes of a polyacrylamide gel run in 90% formamide. After autoradiography, the base-paired nucleotides are definitively located by comparing V1 generated bands with fragments of known length produced by both Neurospora endonuclease and base-specific ribonucleases. Using the substrates yeast tRNAPhe an E, coli tRNAfMet of known three-dimensional structure, we find V1 nuclease to cleave entirely within every base-paired stem. Our studies also reveal that nuclease V1 will digest paired nucleotides not hydrogen-bonded by standard Watson-Crick base-pairing. In yeast tRNAPhe cleavage of both wobble base-pairs and nucleotides involved in tertiary base-base hydrogen bonding is demonstrated.

Chemical Phenomena↗
PubMed1981

Labeling of eukaryotic messenger RNA 5' terminus with phosphorus -32: use of tobacco acid pyrophosphatase for removal of cap structures.

In recent years, there has been a growing appreciation of the potential applications of 5'-32P-end-labeled mRNA, not only for screening recombinant clones and mapping gene structure, but also for revealing possible nucleotide sequence and structural signals within mRNA molecules themselves, which may be important for eukaryotic mRNA processing and turnover and for controlling differential rates of translational initiation. Three major problems, however, have retarded progress in this area, lack of methods for efficient and reproducible removal of m7G5ppp5'-cap structures, which maintain the integrity of an RNA molecule; inability to generate a sufficient amount of labeled mRNA, owing to the limited availability of most pure mRNA species; and the frequent problem of RNA degradation during in vitro end-labeling owing to RNAse contamination. The procedures presented here permit one to decap and label minute quantities of mRNA, effectively. Tobacco acid pyrophosphatase is relatively efficient in removing cap structures from even nanogram quantities of available mRNA, and enough radioactivity can be easily generated from minute amounts ofintact mRNA with very high-specific-activity [gamma-32P]ATP and the inhibition of ribonuclease contamination with diethylpyrocarbonate. These procedures can be modified and applied to almost any other type of RNA molecule as well. In Section III of this volume, we explore in detail how effectively 5'-end-labeled mRNA can be used not only for nucleotide sequence analysis, but also for mapping mRNA secondary structure.

Adenosine Triphosphate↗
PubMed1980

Secondary structure of mouse and rabbit alpha- and beta-globin mRNAs: differential accessibility of alpha and beta initiator AUG codons towards nucleases.

The nucleotide sequence from the 5' terminus inward of one third of mouse alpha- and beta maj-globin messenger RNAs has been established. In addition, using 5' 32P end-labeled mRNAs as substrates and S1 and T1 nucleases as probes for single-stranded regions, the secondary structures of mouse and rabbit alpha- and beta-globin mRNAs have been analyzed. Our results indicate that the AUG initiator codon in both mouse and rabbit beta-globin mRNA is quite susceptible to cleavage with S1 and T1 nucleases, suggesting that it resides in a single-stranded exposed region. In contrast, the initiator AUG in the alpha-globin mRNA of both species is inaccessible to cleavage, indicating that it is either buried by tertiary structure or is base-paired. Since the rate of initiation of protein synthesis with beta-globin mRNA in rabbit reticulocyte is 30--40% faster than for alpha-globin mRNA, these results imply a possible correlation between the differential rates of initiation with these two mRNAs and the accessibility of the respective AUG initiator codons.

Animals↗
PubMed1979

Nucleotide sequence at the 5' terminus of adenovirus 2 late messenger RNA.

One major late promoter is transcriptionally active for the majority of adenovirus 2 late RNA synthesis. Nucleotide sequences proximal to this promoter are spliced onto the 5' termini of all messenger RNAs generated from it. We report here the complete nucleotide sequence of the capped 5-'terminal undecanucleotide common to these late mRNAs. The sequence m7G5'ppp5'm6AmCUCUCUUCCGp shows striking similarities to the 5'-terminal sequences of the eukaryotic alpha- and beta-globin mRNAs and contains the sequence 5'CUUCCG3' complementary to a six-base sequence near the 3' terminus of most eukaryotic 18 S ribosomal RNAs. On the basis of this sequence and the finding that this same sequence is present at the 5' end of adenovirus 2 late nuclear RNA precursor, it should now be possible to locate the major late promotor within the adenoviral genomic DNA sequence.

Adenoviruses, Human↗
PubMed1978

Sequence analysis of 5'[32P] labeled mRNA and tRNA using polyacrylamide gel electrophoresis.

Sequence analysis of 5'-[32P] labeled tRNA and eukaryotic mRNA using an adaptation of a method recently described by Donis-Keller, Maxam and Gilbert for mapping guanines, adenines and pyrimidines from the 5'-end of an RNA is described. In addition, a technique utilizing two-dimensional polyacrylamide gel electrophoresis for identification of pyrimidines within a sequence is described. 5'-[32P] Labeled rabbit beta-globin mRNA and N. crassa mitochondrial initiator tRNA were partially digested with T1- RNase for cleavage at G residues, with U2-RNase for cleavage at A residues, with an extracellular RNase from B. cereus for cleavage at pyrimidine residues and with T2-RNase or with alkali for cleavage at all four residues. The 5'-[32P] labeled partial digestion products were separated according to their size, by electrophoresis in adjacent lanes of a polyacrylamide slab gel and the location of G's, A's and of pyrimidines extending 60-80 nucleotides from the 5'-end of the RNA determined. Two-dimensional polyacrylamide gel electrophoresis was used to separate the 5'-[32P] labeled fragments present in partial alkali digests of a 5'-[32P] labeled mRNA. The mobility shifts corresponding to the difference of a C residue were distinct from those corresponding to a U residue and this formed the basis of a method for distinguishing between the pyrimidines.

Animals↗
PubMed1978

Requirement for 7-methylguanosine in translation of globin mRNA in vivo.

The 7-methylguanosine (m7G) residue present in the m7G5' ppp5'X-"CAP" structure of rabbit globin mRNA was removed quantitatively by periodate oxidation followed by beta-elimination in the presence of cyclohexylamine. The RNA thus treated was intact and exhibited no signs of degradation as examined by polyacrylamide gel electrophoresis in formamide. Assay for protein synthesis using a wheat germ cell-free system showed that the globin mRNA lacking m7G had lost most of its messenger activity. Identical treatment, of satellite tobacco necrosis virus (STNV) RNA, which does not contain the 5'-terminal "CAP" structure, resulted in no loss of its mRNA activity. Since the importance of the m7G residue in eukaryotic mRNA has not yet been shown essential for translation in vivo, both untreated and treated globin mRNAs were injected into frog oocytes and their translation into globin was measured at intervals over a ninety-six hour period. Globin mRNA either treated with periodate alone or lacking in m7g altogether were both found to have lost more than 90% of their activity in vivo.

Animals↗
PubMed1977

Nucleotide sequence of 5' terminus of alfalfa mosaic virus RNA 4 leading into coat protein cistron.

The sequence of the 5'-terminal 74 nucleotides of alfalfa mosaic virus RNA 4, the mRNA for the viral coat protein, has been deduced by using various new techniques for labeling the RNA at the 5' end with 32P and for sequencing the 5'-32P-labeled RNA. The sequence is NpppGUUUUUAUUUUUAAUUUUCUUUCAAAUACUUCCAUCAUGAGUUCUUCACAAAAGAAAGCUGGUGGGAAAGCUGG. The AUG initiator codon is located 36 nucleotides in from the 5' end; the nucleotide sequence beyond corresponds to the amino acid sequence of the coat protein. This 5' noncoding region is rich in U (58% U); except for the 5'-terminal G, the next G in is part of the initiator AUG codon.

Base Sequence↗