Biomedical subjects

R Frade

Publications and source records attributed to R Frade.

At least 37 records · Page 2Linked to original sources

PubMed1995

Wild-type p53 regulates its own transcription in a cell-type specific manner.

Wild-type (w.t.) p53 acts as a transcriptional regulator that binds to DNA and modulates transcription of several promoters. Wild-type p53 has also been shown to autoregulate its own transcription. There is no agreement, however, on whether w.t. p53 has trans-activates or downregulates its own transcription. To further explore the transcriptional autoregulation of the p53 gene, we analyzed the effect of w.t. p53 on its own promoter in different cell lines that do not express p53. A DNA domain within the human p53 promoter (-48 to -23) with the structure of ATGGGATTGGGGTTTTCCCCTCCCAT shares 8 of 10 nucleotides sequence homology with the p53 binding motif. When the human p53 promoter that included this domain was linked to a chloramphenicol acetyltransferase (CAT) gene and coexpressed with w.t. or mutated p53 in cells lacking p53 protein, w.t. p53 down-regulated its own promoter in SAOS-2 and K562 cells, but not in DP15 cells. We were unable to detect direct interaction of p53 with its promoter or to domain -48 to -23 following transfection of these cells with w.t. p53. A different pattern of protein--DNA complexes was observed, however, between the p53 promoter and nuclear extracts from SAOS-2 and DP15 cells following transfection with w.t. p53. These data suggest that w.t. p53 autoregulates its own promoter indirectly and in a cell type-specific manner.

Amino Acid Sequence↗

PubMed1994

Human erythrocyte ankyrin, a cytoskeleton component, generates the p57 membrane proteinase which cleaves C3, the third component of complement.

Human erythrocytes express a p57 membrane serine proteinase which cleaves C3, the third component of complement. Amino acid analysis of the first 20 N-terminal residues of the purified p57 proteinase demonstrated 100% homology with residues 910-929 of erythrocyte ankyrin, a sequence localized in its Mr = 62 kDa fragment. Thus, we analyzed whether ankyrin could generate the p57 C3-cleaving activity. We demonstrate herein that: 1) anti-ankyrin antibodies react with purified p57 proteinase; 2) anti-p57 proteinase antibodies react with purified ankyrin but not with spectrin, another cytoskeleton component; 3) while purified ankyrin did not carry any detectable proteinase activity, limited proteolysis of ankyrin by immobilized chymotrypsin generated this C3-cleaving serine proteinase. Spectrin did not generate any C3-cleaving activity. This is the first demonstration that erythrocyte ankyrin could generate a proteinase activity, which in addition, cleaves specifically human C3.

Amino Acid Sequence↗

PubMed1992

EBV/C3d receptor (CR2) interacts by its intracytoplasmic carboxy-terminal domain and two distinct binding sites with the p53 anti-oncoprotein and the p68 calcium-binding protein.

EBV/C3d receptor (CR2) interacts with the p53 anti-oncoprotein expressed in the human B lymphoma cells, Raji but not in normal B cells, and with the p68 calcium-binding protein, expressed in normal B lymphocytes but not in transformed B lymphocytes. To characterize the CR2 domain interacting with these two intracellular proteins, we synthesized a 34-amino acid peptide, pep34, corresponding to its intracytoplasmic carboxy-terminal domain and analyzed its binding and antigenic properties. Binding of 125I-labeled p53 or 125I-labeled p68 on immobilized pep34 was specific, additive, and totally inhibited by unlabeled p53 or p68, respectively, but not by unlabeled p68 or p53, respectively. Antigenic properties of pep34 were analyzed by immunizing rabbits with particle-bound pep34. Polyclonal anti-pep34 Ab carried anti-CR2 specificities that recognized only the intracellular domain of CR2. In addition, anti-pep34 Ab also carried anti-p53 or anti-p68 specificities. Anti-p53 or anti-p68 specificities were not due to putative common structural or conformational antigenic determinants between the pep34 synthetic peptide and the p68 or p53 proteins. These anti-p53 and anti-p68 specificities were identified as anti-idiotypic anti-CR2 Ab mimicking either p53 or p68 binding sites of CR2. These data clearly establish that despite its short length, the intracytoplasmic C-terminal tail of CR2 is involved in direct protein-protein interactions with the two intracellular regulatory proteins, p53 and p68. An additional feature of these data is the demonstration that particle-bound pep34 triggered "in vivo" anti-Id Ab restricted to either p53 or p68 specificities.

Amino Acid Sequence↗

PubMed1992

A 16 amino acid synthetic peptide derived from human C3d triggers proliferation and specific tyrosine phosphorylation of transformed CR2-positive human lymphocytes and of normal resting B lymphocytes.

We demonstrate herein that p16, a 16 amino acid synthetic peptide derived from human C3d, which carried LYNVEA sequence of C3d reacting with CR2 and C3d present in trypsin-cleaved C3, triggered "in vitro" and "in vivo" phosphorylations and "in vitro" proliferation of human B lymphocytes, depending on the stage of cell differentiation. Indeed, p16 and C3dT induced "in vivo" tyrosine phosphorylation of pp105 and "in vitro" proliferation only of CR2-positive and not of CR2-negative cell lines. In addition, p16 and C3dT also induced "in vivo" tyrosine phosphorylation of pp100 and "in vitro" proliferation of only small dense resting B lymphocytes and not other B lymphocyte subpopulations nor T lymphocytes. These data suggest that induction of pp100 and pp105 phosphorylation by p16 and C3dT could represent an early event associated with expression of CR2 in the regulation of human B lymphocyte proliferation.

Amino Acid Sequence↗

PubMed1992

Nuclear localization of the Epstein-Barr virus/C3d receptor (CR2) in the human Burkitt B lymphoma cell, Raji.

Epstein-Barr virus/C3d receptor (CR2) is a glycoprotein of mol. wt 140,000 expressed on the surface of Raji cells. We previously isolated phosphorylated CR2 from purified Raji cell nuclei. We have analyzed the nuclear localization of CR2 by electron microscope immunochemistry of thin sections of Raji cells and we have compared the binding properties of CR2 expressed on purified plasma membranes or nuclei. Anti-CR2 mAb immunogold labeling of thin sections of Raji cells identified CR2 at the nuclear surface and also within the nucleus. Nuclear envelope associated CR2 was localized mainly at nuclear pores. Within the nucleus, CR2 was associated with ribonucleoprotein (RNP) interchromatin fibrils. This labeling was preserved in nuclear matrix preparations. CR2 expressed on the surfaces of purified nuclei or on the cell surface interacted with soluble and particle-bound C3bi/C3d. Monoclonal anti-CR2 antibodies, which recognized extracellular domains of CR2, reacted differently with CR2 depending on its subcellular localization. The presence of CR2 in nuclei may be due to translocation of the cell surface CR2 and/or the presence of two distinct intracellular pathways for mature CR2.

Antigens, Differentiation, B-Lymphocyte↗

PubMed1991

Intracellular interaction of EBV/C3d receptor (CR2) with p68, a calcium-binding protein present in normal but not in transformed B lymphocytes.

To analyze direct intracellular interactions of CR2 in normal human B lymphocytes, we used polyclonal anti-Id anti-CR2 antibodies (Ab2) prepared against the highly purified CR2 molecule (gp140) as original immunogen. We previously demonstrated that this Ab2 contained specificities that mimicked extracellular and intracellular domains of CR2 and was helpful for identifying CR2-specific ligands. Indeed, some Ab2 specificities recognized human C3d and EBV, two extracellular CR2 ligands. In addition, other Ab2 specificities interacted directly, as CR2, with the intracellular p53 antioncoprotein that is expressed in transformed cells and not in normal cells. We demonstrate herein that Ab2 detected in normal B lymphocytes a 68-kDa protein, p68, that was not expressed in transformed B cells. p68 was localized in purified plasma membranes and cytosol fractions. Direct interaction of purified CR2 with purified p68 was demonstrated. Competitive studies supported that CR2 and Ab2 interacted with identical sites on p68. These interactions were calcium dependent. p68 was identified as a calcium-binding protein by its ability to be solubilized from B lymphocyte membranes by EGTA, a calcium-chelating agent, to bind specifically on phenothiazine-Sepharose in a calcium-dependent interaction, and to be recognized by specific antibodies directed against human p68, a calcium-binding protein of the annexin VI family. Thus, demonstration of different intracellular interactions of CR2 with distinct regulatory proteins, such as p53, the antioncoprotein, and p68, a calcium-binding protein, supports involvement of two regulatory pathways of signal transduction through CR2, depending on the normal or transformed state of human B lymphocytes.

Annexin A6↗

PubMed1991

A 16 amino-acid synthetic peptide, derived from human C3d, carries regulatory activity on in vitro phosphorylation of a cellular component of the human B lymphoma cells, Raji.

We present herein the first evidence that human C3 and, with a higher efficiency, trypsin-cleaved C3 enhanced in vitro phosphorylation of a cellular component, characterized by an apparent molecular weight of 105 kDa, pp105, present in the human B lymphoma cells, Raji. This regulatory activity was associated with C3d fragment generated in trypsin-cleaved C3. A 16 amino-acid peptide, carrying the LYNVEA sequence of C3d reacting with the C3d receptor (CR2), was synthetized. P16 enhanced, in a dose-dependent curve between 0.3 to 10 microM, in vitro phosphorylation of pp105, as well as C3d fragments present in trypsin-cleaved C3. A fibrinogen-related synthetic peptide of 15 amino acids, used as control, had no effect on pp105 phosphorylation. P16 and trypsin-cleaved C3 regulate pp105 phosphorylation through identical pathways. Thus, p16 represents the 16 amino-acid sequence of C3 which regulated in vitro phosphorylation of pp105.

Amino Acid Sequence↗

PubMed1991

Characterization of a monoclonal antibody against P57, the C3/C3b-cleaving proteinase expressed in human erythrocyte membranes.

A monoclonal antibody was raised against p57, a serine proteinase, characterized by an apparent molecular weight of 57 kDa, and purified from human erythrocyte membranes. P57 proteinase cleaves the human third component of complement, C3. The antibody selected, MP1, of IgG2a isotype, precipitated specifically the p57 antigen which carried the C3/C3b-cleaving activity present in membrane crude extract of human erythrocytes. P57 proteinase eluted from MP1-sepharose was inhibited by 5 x 10(-4) M PMSF, enhanced by 0.5% SDS and generated C3 fragments identical to those generated by membrane crude extract of human erythrocytes. All these properties were identical to those of the p57 previously purified by biochemical procedures. In addition, 5000 binding sites were detected on cell surface. This MP1 monoclonal antibody will be helpful to analyse the role of p57 in human erythrocytes.

Antibodies, Monoclonal↗

PubMed1990

C3-cleaving membrane proteinase. A new complement regulatory protein of human melanoma cells.

Human melanoma cells resistant to killing by the R24 mAb and human complement rapidly degrade surface-deposited C3b (M. Panneerselvam, S. Welt, L. J. Old, C.-W. Vogel. 1986. J. Immunol. 136:2534). We report that C-resistant melanoma cells express a membrane proteinase that can cleave C3b, generating a cleavage product with a molecular mass of approximately 30 kDa. The C3-cleaving proteinase was identified on the melanoma cells by its cross-reaction with antiserum to p57, a C3-cleaving proteinase previously isolated from human E membranes (C. Charriaut-Marlangue, M. Barel, R. Frade. 1986. Biochem. Biophys. Res. Commun. 140:1113). Preincubation of the C-resistant melanoma cells with anti-p57 IgG or their F(ab')2 fragments increased their susceptibility to complement killing from 25% to approximately 50% and reduced the rate of C3b cleavage and the amount of the 30-kDa fragment generated on the cells. Anti-p57 IgG stained C-resistant melanoma cells by indirect immunofluorescence and precipitated a protein with an apparent molecular mass of 65 kDa. This membrane protein, termed p65, was not detectable on C-susceptible melanoma cells. Membrane extracts from C-resistant melanoma cells also showed C3-cleaving activity when incubated with purified C3 or C3b, similarly generating a C3 fragment of approximately 35 kDa. This fluid-phase C3 cleaving activity could be partially inhibited by anti-p57 IgG. These data suggest that p65 is a C3-cleaving proteinase, antigenically related to p57, that is expressed on C-resistant melanoma cells and responsible for the C resistance of these cells. We propose that the membrane-bound C3-cleaving proteinase represents another C regulatory protein protecting host cells against killing by C.

Blotting, Western↗

PubMed1990

Structure and signalling functions of C3 receptors on human B cells.

CR1 (C3b receptor) and CR2 (C3d/EBV receptor) are two C3 receptors expressed on B lymphocytes. CR1 and CR2 have structural similarities and their cross-linking at the B cell surface by antibodies or specific ligands in multimeric forms induce B cell activation. However, activation of human B cells through cell surface interactions or by intracellular protein kinase C activators leads to phosphorylation of CR2 but not CR1. CR2 is phosphorylated on serine and tyrosine residues. Analysis of post-membrane events associated with CR2 revealed intracellular interactions of CR2 with p53, a plasma membrane anti-oncogene-encoded phosphoprotein, and with p120, a nuclear phosphoribonucleoprotein. These intracellular interactions probably represent important steps in the signalling functions of CR2.

Antigens, Differentiation, B-Lymphocyte↗

PubMed1989

Enhancement of Epstein-Barr virus/C3d receptor (EBV/C3dR or CR2) and nuclear p120 ribonucleoprotein phosphorylation by specific EBV/C3dR ligands in subcellular fractions of the human B lymphoma cell line, Raji.

We present herein the first evidence that interaction of specific EBV/C3dR ligands, as human C3bi/C3d and anti-EBV/C3dR MoAb, with EBV/C3dR enhanced significantly, in a dose dependent process, phosphorylation of EBV/C3dR and p120 RNP present in subcellular fractions, as purified plasma membranes and nuclei, of the human B lymphoma cell line, Raji. The use of kinase effectors allowed to detect some of the kinases involved in these phosphorylations. Pp60src-like phosphotyrosine kinase and protein kinase C were involved in the phosphorylation of plasma membrane or nuclear EBV/C3dR. An additional calcium/calmodulin-dependent kinase was also involved in nuclear EBV/C3dR phosphorylation. P120 RNP phosphorylation was under the control of protein kinase C and of CaCl2/Calmodulin-dependent kinase but also of casein kinase II.

Burkitt Lymphoma↗

PubMed1989

Epstein-Barr virus/complement fragment C3d receptor (CR2) reacts with p53, a cellular antioncogene-encoded membrane phosphoprotein: detection by polyclonal anti-idiotypic anti-CR2 antibodies.

Epstein-Barr virus and the C3d fragment of the third component of complement are specific extracellular ligands for complement receptor type 2 (CR2). However, intracellular proteins that react specifically with CR2 and are involved in post-membrane signals remain unknown. We recently prepared polyclonal anti-idiotypic anti-CR2 antibodies (Ab2) by using the highly purified CR2 molecule as original immunogen. We showed that Ab2 contained anti-idiotypic specificities that mimicked extracellular domains of CR2 and detected two distinct binding sites on CR2 for its specific extracellular ligands, Epstein-Barr virus and C3d. We postulated that Ab2 might also contain specificities that could mimic intracellular domains of CR2. Here we report that Ab2, which did not react with Raji B-lymphoma cell surface components, detected specifically, among all components solubilized from Raji cell membranes, a single intracellular membrane protein of apparent molecular mass of 53 kDa. This protein was identified as the p53 cellular antioncogene-encoded membrane phosphoprotein by analyzing its antigenic properties with Pab1801, a monoclonal anti-p53 antibody, and by comparing its biochemical properties with those of p53. Additionally, solubilized and purified CR2 bound to solubilized p53 immobilized on Pab1801-Sepharose. p53, like CR2, was localized only in purified plasma membranes and nuclei of Raji cells. These data suggest strongly that p53, a cellular antioncogene-encoded phosphoprotein, reacted specifically with CR2 in Raji membranes. This interaction may represent one of the important steps through which CR2 could be involved in human B-lymphocyte proliferation and transformation.

Antibodies↗

PubMed1988

Monoclonal and anti-idiotypic anti-EBV/C3d receptor antibodies detect two binding sites, one for EBV and one for C3d on glycoprotein 140, the EBV/C3dR, expressed on human B lymphocytes.

Glycoprotein (gp) 140, the EBV/C3dR of B lymphocytes, is a membrane site involved in human cell regulation. To analyze the specificities of the binding sites for EBV and for C3d on the gp 140 molecule, two distinct approaches were used. First, anti-EBV/C3dR mAb were prepared against highly purified EBV/C3dR. Nine anti-EBV/C3dR mAb were obtained. Four of these anti-EBV/C3dR mAb inhibited C3d binding but not EBV binding on gp 140, whereas four others exerted an inverse effect. These differences could not be due to differences in isotype, antibody concentration, affinity constant, and number of molecules bound on cell surface, as these parameters were identical for the nine used mAb. Second, polyclonal anti-idiotypic antibodies (Ab2) were prepared against F(ab)'2 fragments of polyclonal anti-EBV/C3dR (Ab1). Ab2 recognized the variable portion of Ab1 as controlled by immunoblotting experiments. Ab2, which did not react with the cell surface, inhibited Ab1 binding on Raji cells. Ab2 mimicked the EBV/C3dR by its properties to bind to particle-bound C3d and EBV, preventing their binding on Raji cell surface. C3d binding specificities contained in Ab2 were isolated by affinity chromatography on C3b/C3bi-Sepharose. These specificities, being the internal image of C3d binding site of EBV/C3dR, reacted with Ab1 and inhibited particle-bound C3d binding on Raji cells but did not react with EBV. Taken together, these data support strongly that gp 140, the EBV/C3dR, carried two distinct binding sites, one for EBV and one for C3d.

Animals↗

PubMed1987

Activation of human platelets through gp140, the C3d/EBV receptor (CR2).

gp140, the C3d/EBV receptor (CR2), previously isolated and characterized from human B lymphocytes, was identified on human platelets: by measuring the specific binding of either polyclonal anti-gp140 IgG and monoclonal anti-C3d/EBVR antibodies, as OKB-7 and HB-5, or human C3d; by isolating gp140 from solubilized platelet components with polyclonal anti-gp140 IgG or monoclonal OKB-7, using immunoprecipitation and electro-immunoblotting assays; by inducing specific activation of human platelets. Cross-linking of this receptor by polyclonal anti-gp140 IgG induced aggregation of human platelets and stimulated ATP release. Absence of lactate dehydrogenase release and inhibition by EDTA and prostacyclin of anti-gp140-induced aggregation, support strongly active aggregation and absence of lysis. Platelet aggregation by anti-gp140 required metabolic activities and was modulated by fibrinogen, paf-acether or thrombin. OKB-7 triggered human platelet aggregation when cross-linked by anti-mouse second-step antibodies. In the same way, platelet activation by C3d fragment was detected, in presence of fibrinogen, only when C3d was cross-linked on the cell surface by anti-C3d F(ab')2 fragments.

Adenosine Triphosphate↗

PubMed1987

Activation of B lymphocytes by Epstein-Barr virus/CR2 receptor interaction.

Epstein-Barr virus (EBV) infects and transforms human B lymphocytes. The virus receptor was shown to be identical to the complement receptor CR2. The consequences of EBV/CR2 receptor interaction on B lymphocyte activation were analyzed by infection of B cells with the transforming (B95-8) and the nontransforming (P3HR1) virus strains and with UV-inactivated B95-8 virus. Similar to mitogens and antibodies against surface IgM and CR2 receptor, transforming and nontransforming EBV induced the release of leukocyte migration inhibitory factor (LIF). LIF production occurred early after infection and was not affected by irradiation of the B95-8 virus with doses of UV-light which prevented the expression of viral functions. B lymphocytes infected with UV-inactivated virus responded to T cell-derived B cell growth factors. The results demonstrate that binding of EBV to the CR2 receptor activates the B cells. Progression of the infected cells in the activation pathway required helper cell-derived factors or signals provided by the intact viral genome. The nontransforming P3HR1 virus induced a low level of RNA synthesis and increase of cell size and major histocompatibility complex class I antigen expression. Only the transforming virus induced expression of EBV nuclear antigens and cellular DNA synthesis.

Antibodies↗

PubMed1987

gp140, the EBV/C3d receptor (CR2) of human B lymphocytes, is involved in cell-free phosphorylation of p120, a nuclear ribonucleoprotein.

gp140, the EB/C3d receptor (EBV/C3dR; CR2), is a membrane site involved in human B cell regulation. Cross-linking of this receptor on the cell surface by its specific ligands led to the enhancement of B cell proliferation in synergy with T cell factors. In vitro activation of human peripheral B lymphocytes by cross-linking membrane immunoglobulins with anti-mu antibody induced EBV/C3dR phosphorylation. These studies were pursued by analyzing cell-free phosphorylation of EBV/C3dR isolated from Raji cell fractions, and immobilized on OKB7, a monoclonal anti-EBV/C3dR antibody. Three EBV/C3dR-related antigens which could be cell-free phosphorylated were detected: gp140, the EBV/C3dR, p130 and p120. gp140, the mature form of EBV/C3dR, was isolated from plasma membrane and from purified nuclei. p130 was identified as an intracellular intermediate of EBV/C3dR glycosylation, localized in low-density microsomes. Phosphoamino acid analysis of EBV/C3dR allowed the detection of phosphotyrosine and phosphoserine residues. These data suggest that EBV/C3dR could carry an autophosphorylation activity and could be associated to serine kinases. Using polyclonal anti-p120 antibody and anti-120 kDa nuclear ribonucleoprotein monoclonal antibody (mAb), p120 was identified as a nuclear ribonucleoprotein antigenically not related to EBV/C3dR. Detection of p120 on EBV/C3dR, immobilized on OKB7, was due to interactions between both antigens, instead of anti-EBV/C3dR mAb cross-reactivity with p120. Cell-free phosphorylation of p120 was under the control of EBV/C3dR. However, it is not yet established whether other nuclear or membrane components were involved in the control of p120 cell-free phosphorylation by EBV/C3dR. From the data presented herein, we propose that phosphorylation of a 120-kDa nuclear ribonucleoprotein by EBV/C3dR-associated kinases could represent a crucial step in in vivo regulation of human B cell activation.

B-Lymphocytes↗

PubMed1986

Identification of P-57, a serine proteinase, from human erythrocyte membranes, which cleaves both chains of human third component (C3) of complement.

A proteinase, which cleaves human third component of complement, was solubilized from erythrocyte membranes then purified by gel filtration chromatography, fluid phase electrophoresis, and hydroxylapatite chromatography. Labeling of the purified material by 125I or 3H-DFP and measurement of proteolytic activity subsequently isolated by SDS-polyacrylamide gel electrophoresis allowed to identify a 57 kDa single band, in non reducing conditions. Inhibition of this activity by PMSF supports covalent modification of an active serine residue. This membrane serine proteinase cleaved alpha and beta chains of human third component of complement, suggesting that p-57 is distinct from plasma serine proteinases.

Centrifugation, Density Gradient↗

PubMed1986

gp 140, the C3d/EBV receptor (CR2), is phosphorylated upon in vitro activation of human peripheral B lymphocytes.

gp 140, the C3d/EBV receptor (CR2), is a specific marker of human B lymphocytes. Very recent data suggest that CR2 is a membrane site involved in early B cell activation. These properties of CR2 led us to analyze the molecular events associated with gp 140. We analyzed whether in some conditions of B lymphocyte activation, CR2 could be phosphorylated. We have found that when highly enriched peripheral B cells were cultured for 48 h with anti-mu Ab and/or SAC, in order to provide an optimal activating signal, phosphorylation of the CR2 was induced.

B-Lymphocytes↗