Biomedical subjects

R Garesse

Publications and source records attributed to R Garesse.

At least 19 recordsLinked to original sources

PubMed2005

Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE.

We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP).

Blotting, Southern↗

PubMed2003

Myoglobinuria and COX deficiency in a patient taking cerivastatin and gemfibrozil.

The authors describe a patient who presented with myoglobinuria after starting cerivastatin-gemfibrozil therapy. Muscle histochemistry revealed ragged-red fibers and cytochrome c oxidase negative (COX) fibers, and biochemistry showed a defect of COX activity. Immunoblot analysis showed a 60% reduction of COX I and COX II polypeptides. Cerivastatin myotoxicity might be related to a depletion of essential metabolites needed to anchor COX subunit I to mitochondrial membrane.

Aged↗

PubMed2003

Mutation analysis in 16 patients with mtDNA depletion.

Sixteen unrelated Southern European patients with the mitochondrial depletion syndrome (MDS) were analyzed for mutations in the TK2 and DGUOK genes. Three novel mutations were identified in TK2 (R183G, R254X, and 142insG). When we analyzed additional genes involved in the dNTPs pool, such as SLC25A19 (DNC) and NT5M (d-NT2), we did not detect mutations. The current study suggest that scanning the TK2, DGUOK, SLC25A19, and NT5M genes is likely to help about 10% of MDS families in terms of genetic counseling. Also, our findings indicate that genotype-phenotype correlations are not straightforward in MDS.

Age of Onset↗

PubMed2001

Mitochondrial dysfunction associated with a mutation in the Notch3 gene in a CADASIL family.

BACKGROUND: Cerebral autosomal arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is characterized by recurrent subcortical ischemic strokes and dementia caused by mutations in the Notch3 gene. In Drosophila melanogaster, Notch signaling has a pleiotropic effect, affecting most tissues of the organism during development. OBJECTIVE: To characterize a potential mitochondrial dysfunction associated with mutations in the Notch3 gene. METHODS: Biochemical, histochemical, molecular, and genetic analyses were performed on muscle biopsy specimens and fibroblasts obtained from patients of a Spanish family with CADASIL. Additional biochemical and molecular analyses of the N(55e11) mutant of D. melanogaster were performed. RESULTS: In muscle biopsy specimens, a significant decrease was found in the activity of complex I (NADH [reduced form of nicotinamide adenine dinucleotide] dehydrogenase), and in one patient, histochemical analysis showed the presence of ragged-red fibers with abnormal cytochrome c oxidase staining. Reduced fibroblast activity of complex V (ATP synthase) was found. Supporting data on patients with CADASIL, it was found that the mutation N(55e11) in Drosophila decreases the activity of mitochondrial respiratory complexes I and V. CONCLUSIONS: Mitochondrial respiratory chain activity responds, directly or indirectly, to the Notch signaling pathway. Mitochondrial dysfunction in patients with CADASIL may be an epiphenomenon, but results of this study suggest that the pathophysiology of the disease could include a defect in oxidative phosphorylation.

Adult↗

PubMed2001

Animal mitochondrial biogenesis and function: a regulatory cross-talk between two genomes.

Mitochondria play a pivotal role in cell physiology, producing the cellular energy and other essential metabolites as well as controlling apoptosis by integrating numerous death signals. The biogenesis of the oxidative phosphorylation system (OXPHOS) depends on the coordinated expression of two genomes, nuclear and mitochondrial. As a consequence, the control of mitochondrial biogenesis and function depends on extremely complex processes that require a variety of well orchestrated regulatory mechanisms. It is now clear that in order to provide cells with the correct number of structural and functional differentiated mitochondria, a variety of intracellular and extracellular signals including hormones and environmental stimuli need to be integrated. During the last few years a considerable effort has been devoted to study the factors that regulate mtDNA replication and transcription as well as the expression of nuclear-encoded mitochondrial genes in physiological and pathological conditions. Although still in their infancy, these studies are starting to provide the molecular basis that will allow to understand the mechanisms involved in the nucleo-mitochondrial communication, a cross-talk essential for cell life and death.

Animals↗

PubMed2001

Early-onset multisystem mitochondrial disorder caused by a nonsense mutation in the mitochondrial DNA cytochrome C oxidase II gene.

We report the first nonsense mutation (G7896A) in the mtDNA gene for subunit II of cytochrome c oxidase (COX) in a patient with early-onset multisystem disease and COX deficiency in muscle. The mutation was heteroplasmic in muscle, blood, and fibroblasts from the patient and abundantly present in COX-deficient fibers, but less abundant in COX-positive fibers; it was not found in blood samples from the patient's asymptomatic maternal relatives. Immunoblot analysis showed a reduced concentration of both COX II and COX I polypeptides, suggesting impaired assembly of COX holoenzyme.

Child, Preschool↗

PubMed2001

A new mtDNA mutation in the tRNA(Leu(UUR)) gene associated with ocular myopathy.

We studied a patient with ptosis, ophthalmoparesis, and exercise intolerance who showed in her muscle biopsy ragged-red fibers and combined defects of the complexes I and IV of the mitochondrial respiratory chain. Molecular analysis revealed a T3273C transition in the mitochondrial DNA tRNA(Leu(UUR)) gene. The mutation was heteroplasmic and very abundant in muscle from the proposita, less abundant in her other tissues studied, and still less abundant in blood from her maternal relatives. Single muscle fiber analysis showed significantly higher levels of mutant genomes in ragged-red fibers than in normal fibers. The T3273C mutation affects a strictly conserved base pair in the anticodon stem and was not found in controls, thus satisfying the accepted criteria for pathogenicity.

Base Sequence↗

PubMed2001

Identification of a proximal promoter region critical for the expression of the beta-F1-ATPase gene during Drosophila melanogaster development.

We have studied the spatio-temporal pattern of expression of the gene encoding the H(+) adenosine triphosphate (ATP) synthase beta subunit (beta-F1-ATPase) during Drosophila melanogaster development. The beta-F1-ATPase mRNA is stored in the egg; as development proceeds it is distributed in most embryonic cellular territories, including the mesoderm, and in late embryos it is highly abundant in the ventral cord and midgut. Using a combination of transfection assays in Schneider cells and P-element transformation in flies, we have identified a proximal 5' upstream region of 258 bp essential for the transcriptional activity of the gene during D. melanogaster embryogenesis that is virtually inactive in adult tissues. Electrophoretic mobility shift assays using specific DNA fragments from the 258-bp region detect in embryonic nuclear extracts a complex set of DNA binding proteins that are largely absent in adults. The transcription factor CF2-II has been identified as a potential candidate in the regulation of the beta-F1-ATPase gene.

Journal Article↗

PubMed2000

Differential regulation of the catalytic and accessory subunit genes of Drosophila mitochondrial DNA polymerase.

The developmental pattern of expression of the genes encoding the catalytic (alpha) and accessory (beta) subunits of mitochondrial DNA polymerase (pol gamma) has been examined in Drosophila melanogaster. The steady-state level of pol gamma-beta mRNA increases during the first hours of development, reaching its maximum value at the start of mtDNA replication in Drosophila embryos. In contrast, the steady-state level of pol gamma-alpha mRNA decreases as development proceeds and is low in stages of active mtDNA replication. This difference in mRNA abundance results at least in part from differences in the rates of mRNA synthesis. The pol gamma genes are located in a compact cluster of five genes that contains three promoter regions (P1-P3). The P1 region directs divergent transcription of the pol gamma-beta gene and the adjacent rpII33 gene. P1 contains a DNA replication-related element (DRE) that is essential for pol gamma-beta promoter activity, but not for rpII33 promoter activity in Schneider's cells. A second divergent promoter region (P2) controls the expression of the orc5 and sop2 genes. The P2 region contains two DREs that are essential for orc5 promoter activity, but not for sop2 promoter activity. The expression of the pol gamma-alpha gene is directed by P3, a weak promoter that does not contain DREs. Electrophoretic mobility shift experiments demonstrate that the DRE-binding factor (DREF) regulatory protein binds to the DREs in P1 and P2. DREF regulates the expression of several genes encoding key factors involved in nuclear DNA replication. Its role in controlling the expression of the pol gamma-beta and orc5 genes establishes a common regulatory mechanism linking nuclear and mitochondrial DNA replication. Overall, our results suggest that the accessory subunit of mtDNA polymerase plays an important role in the control of mtDNA replication in Drosophila.

Animals↗

PubMed2000

Regulation of mitochondrial single-stranded DNA-binding protein gene expression links nuclear and mitochondrial DNA replication in drosophila.

The structural organization of the Drosophila melanogaster gene encoding mitochondrial single-stranded DNA-binding protein (mtSSB) has been determined and its pattern of expression evaluated during Drosophila development. The D. melanogaster mtSSB gene contains four exons and three small introns. The transcriptional initiation site is located 22 nucleotides upstream from the initiator translation codon in adults, whereas several initiation sites are found in embryos. No consensus TATA or CAAT sequences are located at canonical positions, although an AT-rich sequence was identified flanking the major transcriptional initiation site. Northern analyses indicated that the mtSSB transcript is present at variable levels throughout development. In situ hybridization analysis shows that maternally deposited mtSSB mRNA is distributed homogeneously in the early embryo, whereas de novo transcript is produced specifically at an elevated level in the developing midgut. Transfection assays in cultured Schneider cells with promoter region deletion constructs revealed that the proximal 230 nucleotides contain cis-acting elements required for efficient gene expression. Putative transcription factor binding sites clustered within this region include two Drosophila DNA replication-related elements (DRE) and a single putative E2F binding site. Deletion and base substitution mutagenesis of the DRE sites demonstrated that they are required for efficient promoter activity, and gel electrophoretic mobility shift analyses showed that DRE binding factor (DREF) binds to these sites. Our data suggest strongly that the Drosophila mtSSB gene is regulated by the DRE/DREF system. This finding represents a first link between nuclear and mitochondrial DNA replication.

Amino Acid Sequence↗

PubMed2000

The pathogenic role of point mutations affecting the translational initiation codon of mitochondrial genes.

The mutation T3308C results in a Met --> Thr change at the highly conserved amino acid position 1 of the mtDNA ND1 gene (M1T). To study its potential pathogenic effect we have carried out a combination of mitochondrial protein synthesis and Northern and Western analyses. Our data demonstrate that M1T mutation does not affect the efficiency of the synthesis of the ND1 polypeptide and suggest that any codon specifying methionine located close to the 5' end of mitochondrial mRNAs may be used as translational initiator.

Blotting, Northern↗

PubMed2000

The pathophysiology of mitochondrial biogenesis: towards four decades of mitochondrial DNA research.

Mitochondria are with very few exceptions ubiquitous organelles in eukaryotic cells where they are essential for cell life and death. Mitochondria play a central role not only in a variety of metabolic pathways including the supply of the bulk of cellular ATP through oxidative phosphorylation (OXPHOS), but also in complex processes such as development, apoptosis, and aging. Mitochondria contain their own genome that is replicated and expressed within the organelle. It encodes 13 polypeptides all of them components of the OXPHOS system, and thus, the integrity of the mitochondrial DNA (mtDNA) is critical for cellular energy supply. In the past 12 years more than 50 point mutations and around 100 rearrangements in the mtDNA have been associated with human diseases. Also in recent years, several mutations in nuclear genes that encode structural or regulatory factors of the OXPHOS system or the mtDNA metabolism have been described. The development of increasingly powerful techniques and the use of cellular and animal models are opening new avenues in the study of mitochondrial medicine. The detailed molecular characterization of the effects produced by different mutations that cause mitochondrial cytopathies will be critical for designing rational therapeutic strategies for this group of devastating diseases.

Animals↗

PubMed2000

Overexpression of the catalytic subunit of DNA polymerase gamma results in depletion of mitochondrial DNA in Drosophila melanogaster.

The mechanisms involved in the regulation of mitochondrial DNA (mtDNA) replication, a process that is crucial for mitochondrial biogenesis, are not well understood. In this study, we evaluate the role of DNA polymerase gamma (pol gamma), the key enzyme in mtDNA replication, in both Drosophila cell culture and in developing flies. We report that overexpression of the pol gamma catalytic subunit (pol gamma-alpha) in cultured Schneider cells does not alter either the amount of mtDNA or the growth rate of the culture. The polypeptide is properly targeted to mitochondria, yet the large excess of pol gamma-alpha does not interfere with mtDNA replication under these conditions where the endogenous polypeptide is apparently present in amounts that exceed of the demand for its function in the cell. In striking contrast, overexpression of pol gamma-alpha at the same level in transgenic flies interferes with the mtDNA replication process, presumably by altering the mechanism of DNA synthesis, suggesting differential requirements for, and/or regulation of, mtDNA replication in Drosophila cell culture versus the developing organism. Overexpression of pol gamma-alpha in transgenic flies produces a significant depletion of mtDNA that causes a broad variety of phenotypic effects. These alterations range from pupal lethality to moderate morphological abnormalities in adults. depending on the level and temporal pattern of overexpression. Our results demonstrate that although cells may tolerate a variable amount of the pol gamma catalytic subunit under some conditions, its level may be critical in the context of the whole organism.

Animals↗

PubMed2000

The highly compact structure of the mitochondrial DNA polymerase genomic region of Drosophila melanogaster: functional and evolutionary implications.

The structure of a Drosophila melanogaster genomic region containing five tightly clustered genes has been determined and evaluated with regard to its functional and evolutionary relationships. In addition to the genes encoding the two subunits (alpha and beta) of the DNA polymerase gamma holoenzyme, the key enzyme for mitochondrial DNA replication, other genes contained in the cluster may be also involved in the cellular distribution of mitochondria and in the coordination of mitochondrial and nuclear DNA replication. The gene cluster is extremely compact, with very little intergenic space. It contains two bidirectional promoter regions, and particularly notable is the 5' end overlap detected in two of its genes, an exceptional situation in both prokaryotic and eukaryotic genome organization.

Animals↗

PubMed1999

Structure and regulated expression of the delta-aminolevulinate synthase gene from Drosophila melanogaster.

The structure of the single copy gene encoding the putative housekeeping isoform of Drosophila melanogaster delta-aminolevulinate synthase (ALAS) has been determined. Southern and immunoblot analyses suggest that only the housekeeping isoform of the enzyme exists in Drosophila. We have localized a critical region for promoter activity to a sequence of 121 base pairs that contains a motif that is potentially recognized by factors of the nuclear respiratory factor-1 (NRF-1)/P3A2 family, flanked by two AP4 sites. Heme inhibits the expression of the gene by blocking the interaction of putative regulatory proteins to its 5' proximal region, a mechanism different from those proposed for other hemin-regulated promoters. Northern and in situ RNA hybridization experiments show that maternal alas mRNA is stored in the egg; its steady-state level decreases rapidly during the first hours of development and increases again after gastrulation in a period where the synthesis of several mRNAs encoding metabolic enzymes is activated. In the syncytial blastoderm, the alas mRNA is ubiquitously distributed and decreases in abundance substantially through cellular blastoderm. Late in embryonic development alas shows a specific pattern of expression, with an elevated mRNA level in oenocytes, suggesting an important role of these cells in the biosynthesis of hemoproteins in Drosophila.

5-Aminolevulinate Synthetase↗

PubMed1999

A double mutation (A8296G and G8363A) in the mitochondrial DNA tRNA (Lys) gene associated with myoclonus epilepsy with ragged-red fibers.

OBJECTIVE: To define potential pathogenic mitochondrial DNA (mtDNA) point mutations in a patient with myoclonus epilepsy with ragged-red fibers (MERRF) syndrome. BACKGROUND: MERRF syndrome is typically associated with point mutations in the mtDNA tRNALys gene. METHODS: We performed morphologic, biochemical, and genetic analysis of muscle samples from the patient and four relatives. Molecular genetic studies included sequencing, PCR, and restriction enzyme analysis on whole muscle, blood, and single muscle fibers. RESULTS: Muscle biopsy showed cytochrome c oxidase (COX), negative ragged-red fibers (RRF), and a defect of complex I of the mitochondrial respiratory chain. We found an A8296G transition and a G8363A mutation in the mtDNA tRNALYs gene. The A8296G was almost homoplasmic in muscle and blood from the propositus and his oligosymptomatic maternal relatives. The G8363A mutation was heteroplasmic and more abundant in muscle than in blood, and its proportion correlated with clinical severity. Single muscle fiber analysis showed significantly higher levels of G8363A genomes in COX-negative than in normal fibers, and almost homoplasmic levels of mutant A8296G mtDNA in both COX-negative and normal fibers. The two mutations affect highly conserved nucleotides and were not found in controls. CONCLUSIONS: The G8363A mutation is pathogenic; the co-occurrence of the A8296G mutation is of unclear significance and is likely to be a rare polymorphism.

Adult↗

PubMed1998

Mitochondrial gene expression and respiratory enzyme activities in cardiac diseases.

Respiratory enzyme activities and steady-state level of two mitochondrial-encoded transcripts were quantified in heart muscle biopsies from patients suffering various types of cardiomyopathies unrelated to mitochondrial primary disorders. We have found that although the mitochondrial DNA copy number and the concentration of COI and ND4 transcripts remain fairly constant, there is an important increase (up to 6-fold) in respiratory enzyme activities affecting to several oxidative phosphorylation complexes. Idiopathic dilated cardiomyopathy shows the greatest increase, followed by ischemic heart and ventricular hypertrophy due to aortic stenosis. The results suggest an energetic compensatory mechanism in the heart muscle, in the absence of mitochondrial proliferation or activation of mitochondrial gene expression.

DNA, Mitochondrial↗

PubMed1998

Expression of the nuclear gene encoding mitochondrial ATP synthase subunit alpha in early development of Drosophila and sea urchin.

Complementary DNAs encoding nuclear-coded mitochondrial ATP synthase subunit alpha of Drosophila melanogaster and Strongylocentrotus purpuratus were obtained by a combination of library screening and redundant PCR. The entire coding sequence of the precursor polypeptide was inferred for both species. Southern blots to genomic DNA indicated that the gene is almost certainly single-copy in both organisms. Northern blots to RNA from staged developmental series showed that ATP synthase subunit alpha mRNA is represented in the egg, declines in abundance during cleavage, and is replenished by zygotic transcription in both species. However, the extent and timing of these changes differ significantly in the two species studied. Nuclear-coded and mitochondrially encoded ATP synthase genes appear to be temporally co-regulated in Drosophila, but not sea urchin development.

Amino Acid Sequence↗