PubMed Health⌕ Search

Biomedical subjects

R Hooley

Publications and source records attributed to R Hooley.

At least 19 recordsLinked to original sources
PubMed2000

Gibberellin and abscisic acid signalling in aleurone.

The plant hormones gibberellin and abscisic acid regulate gene expression, secretion and cell death in aleurone. The emerging picture is of gibberellin perception at the plasma membrane whereas abscisic acid acts at both the plasma membrane and in the cytoplasm - although gibberellin and abscisic acid receptors have yet to be identified. A range of downstream-signalling components and events has been implicated in gibberellin and abscisic acid signalling in aleurone. These include the Galpha subunit of a heterotrimeric G protein, a transient elevation in cGMP, Ca2+-dependent and Ca2+-independent events in the cytoplasm, reversible protein phosphory-lation, and several promoter cis-elements and transcription factors, including GAMYB. In parallel, molecular genetic studies on mutants of Arabidopsis that show defects in responses to these hormones have identified components of gibberellin and abscisic acid signalling. These two approaches are yielding results that raise the possibility that specific gibberellin and abscisic acid signalling components perform similar functions in aleurone and other tissues.

Abscisic Acid↗
PubMed1998

Plant hormone perception and action: a role for G-protein signal transduction?

Plants perceive and respond to a profusion of environmental and endogenous signals that influence their growth and development. The G-protein signalling pathway is a mechanism for transducing extracellular signals that is highly conserved in a range of eukaryotes and prokaryotes. Evidence for the existence of G-protein signalling pathways in higher plants is reviewed, and their potential involvement in plant hormone signal transduction evaluated. A range of biochemical and molecular studies have identified potential components of G-protein signalling in plants, most notably a homologue of the G-protein coupled receptor superfamily (GCR1) and the G alpha and G beta subunits of heterotrimeric G-proteins. G-protein agonists and antagonists are known to influence a variety of signalling events in plants and have been used to implicate heterotrimeric G-proteins in gibberellin and possibly auxin signalling. Antisense suppression of GCR1 in Arabidopsis leads to a phenotype which supports a role for this receptor in cytokinin signalling. These observations suggest that higher plants have at least some of the components of G-protein signalling pathways and that these might be involved in the action of certain plant hormones.

Arabidopsis↗
PubMed1998

A higher plant seven-transmembrane receptor that influences sensitivity to cytokinins.

BACKGROUND: All organisms perceive and respond to a profusion of environmental and endogenous signals that influence growth, development and behavior. The G-protein signalling pathway is a highly conserved mechanism for transducing extracellular signals, and the superfamily of receptors that have seven transmembrane (7TM) domains is a primary element of this pathway. Evidence that heterotrimeric G proteins are involved in signal transduction in plants is accumulating, prompting speculation that plant 7TM receptors might exist. RESULTS: Using information in the dbEST database of expressed sequence tags, we isolated an Arabidopsis thaliana gene (GCR1) that encodes a protein with seven predicted membrane-spanning domains and other features characteristic of 7TM receptors. The protein shows 18-23% amino-acid identity (46-53% similarity) to, and good colinear alignment with, 7TM receptors from three different families. Its highest sequence identity is with the Dictyostelium cAMP receptors. GCR1 is expressed at very low levels in the roots, stems and leaves of Arabidopsis; it is a single-copy gene which maps close to the restriction fragment length polymorphism marker m291 on chromosome 5. Transgenic Arabidopsis expressing antisense GCR1 under the control of the constitutive cauliflower mosaic virus 35S promoter have reduced sensitivity to cytokinins in roots and shoots, yet respond normally to all other plant hormones. This suggests a functional role for GCR1 in cytokinin signal transduction. CONCLUSIONS: GCR1 encodes the first 7TM receptor homologue identified in higher plants and is involved in cytokinin signal transduction. This discovery suggests that 7TM receptors are ancient and predate the divergence of plants and animals.

Arabidopsis↗
PubMed1998

DNase1 footprints suggest the involvement of at least three types of transcription factors in the regulation of alpha-Amy2/A by gibberellin.

To elucidate the mechanisms by which alpha-amylase genes are expressed in wild oat aleurone, two genes, alpha-Amy2/A and alpha-Amy2/D, were isolated. Both were shown to be positively regulated by gibberellin (GA) during germination and both contain the conserved cis-acting elements Box 2, GA-response element (TAACAGA) and TATCSATSS (where S is C or G). In addition, they possess a conserved initiator element (CATCA) that is present in both alpha-Amy2 and alpha-Amy1 genes, and also in a number of other plant TATA-containing and TATA-less promoters. DNase 1 footprint analysis showed the alpha-Amy2/A promoter to be a complex array of binding sites for a number of different classes of DNA-binding proteins. Our data suggest that the area around the initiator element (Inr) is bound by a large complex of general transcription factors, that the TATA box is bound by the TFIID complex, that Box 2 is bound by one or more WRKY proteins and that the GA-response element is bound by one or more MYBs. Two other elements containing the core sequence CCATGG/C are bound by nuclear protein and this sequence is the core of the Sph element. The regulation of alpha-Amy2 genes by GA therefore involves an interplay of at least three different types of transcription factor.

Avena↗
PubMed1998

Gibberellin-photoaffinity labelling of two polypeptides in plant plasma membranes.

Two polypeptides of M(r) 68 kDa and 18 kDa were gibberellin (GA)-photoaffinity labelled in vitro in plasma membrane preparations from oat (Avena sativa L.) aleurone and from leaves and stems of wild-type and GA-sensitivity mutants of different species. Labelling of these polypeptides could be competed by biologically active, but not by inactive, GAs, indicating the likely biological significance of these interactions. On 2-dimensional gels the radiolabelled polypeptides were each resolved as one intensely labelled low abundance spot with a slightly lower pl form adjacent to it. There was a strong pH dependency for both labelling events, which correlated well with pH values at which GA are known to be most biologically active. A semi-dwarf GA-sensitivity mutant of sweet pea (Lathyrus odoratus L.), lb, showed reduced photoaffinity labelling of both polypeptides compared with the wild type, Lb. In the GA-insensitive Arabidopsis thaliana mutant gai, the level of labelling was the same as in wild type, GAI. This is the first report of GA-binding proteins in plant plasma membranes. Some preliminary sequence data are given for one of the labelled polypeptides. We discuss these mutants and consider their possible roles in GA perception or action.

Affinity Labels↗
PubMed1998

Heterotrimeric G proteins are implicated in gibberellin induction of a-amylase gene expression in wild oat aleurone

The role of heterotrimeric G proteins in gibberellin (GA) induction of a-amylase gene expression was examined in wild oat aleurone protoplasts. Mas7, a cationic amphiphilic tetradecapeptide that stimulates GDP/GTP exchange by heterotrimeric G proteins, specifically induced alpha-amylase gene expression and enzyme secretion in a very similar manner to GA1. In addition, Mas7 stimulated expression of an alpha-Amy2/54:GUS promoter and reporter construct in transformed protoplasts. Both Mas7 and GA1 induction of alpha-amylase mRNA were insensitive to pertussis toxin. Hydrolysis-resistant nucleotides were introduced into aleurone protoplasts during transfection with reporter gene constructs. GDP-beta-S, which inhibits GDP/GTP exchange by heterotrimeric G proteins, completely prevented GA1 induction of alpha-Amy2/54:GUS expression, whereas GTP-gamma-S, which activates heterotrimeric G proteins, stimulated expression very slightly. Novel cDNA sequences from Galpha and Gbeta subunits were cloned from wild oat aleurone cells. By using RNA gel blot analysis, we found that the transcripts were expressed at a low level. Heterotrimeric G proteins have been implicated in several events during plant growth and development, and these data suggest that they may be involved in GA regulation of alpha-amylase gene expression in aleurone.

Journal Article↗
PubMed1996

Galpha12 differentially regulates Na+-H+ exchanger isoforms.

Activation of several GTPases stimulates Na+-H+ exchange, resulting in an increased efflux of intracellular H+. These GTPases include alpha subunits of the heterotrimeric G proteins Gq and G13, as well as the low molecular weight GTP-binding proteins Ras, Cdc42, and Rho (Hooley, R., Yu, C.-Y., Simon, M., and Barber, D. L. (1996) J. Biol. Chem. 271, 6152-6158). GTPases coupled to the inhibition of Na+-H+ exchange, however, have not been identified. Several neurotransmitters, including somatostatin and dopamine, inhibit Na+-H+ exchange through a guanine-nucleotide-dependent mechanism, suggesting the involvement of a GTPase. In this study we determined that mutational activation of the alpha subunit of G12 inhibits the ubiquitously expressed Na+-H+ exchanger isoform, NHE1. Transient expression of mutationally activated Galpha12 inhibited serum- and Galpha13-stimulated NHE1 activity in HEK293 cells and CCL39 fibroblasts. In addition, in NHE-deficient AP1 cells stably expressing specific NHE isoforms, mutationally activated Galpha12 inhibited NHE1 activity but stimulated activities of the Na+-H+ exchanger (NHE) isoforms NHE2 and NHE3. In contrast, mutationally activated Galpha13, another member of the Galpha12/13 family, stimulated all three NHE isoforms. Although previous studies have identified a parallel action of Galpha12 and Galpha13 in regulating MAP (mitogen-activated protein) kinases and cell growth, these GTPases have opposing effects on NHE1 activity.

Animals↗
PubMed1996

G alpha 13 stimulates Na+-H+ exchange through distinct Cdc42-dependent and RhoA-dependent pathways.

Activity of the ubiquitously expressed Na+-H+ exchanger subtype NHE1 is stimulated upon activation of receptor tyrosine kinases and G protein-coupled receptors. The intracellular signaling pathways mediating receptor regulation of the exchanger, however, are poorly understood. Using transient expression of dominant interfering and constitutively active alleles in CCL39 fibroblasts, we determined that the GTPases Ha-Ras and Galpha 13 stimulate NHE1 through distinct signaling cascades. Exchange activity stimulated by constitutively active RasV12 occurs through a Rafl- and mitogen-activated protein kinase kinase/extracellular signal-regulated kinase kinase (MEK)-dependent mechanism. Constitutively active Galpha 13QL, recently shown to stimulate the Jun kinase cascade, activates NHE1 through a Cdc42- and MEK kinase (MEKK1)-dependent mechanism that is independent of Rac1. Constitutively active Rac1V12 does stimulate NHE1 through a MEKK1-dependent mechanism, but dominant interfering Rac1N17 does not inhibit Galpha 13QL-mediated or constitutively active Cdc42V12-mediated stimulation of the exchanger. Conversely, Cdc42NI7 does not inhibit Rac1V12 activation of NHE1, suggesting that Rae I and Cdc42 independently regulate a MEKK1-dependent activation of the exchanger. Rapid (<10 min) stimulation of NHE1 with a Ga13/Gaz chimera also was inhibited by a kinase-inactive MEKK. Galpha 13QL, but not RasV12, also stimulates NHE1 through a RhoA-dependent pathway that is independent of MEKK, and microinjection of mutationally active Galpha 13 results in a Rho phenotype of increased stress fiber formation. These findings indicate a new target for Rho-like proteins: the regulation of H+ ex- change and intracellular pH. Our findings also suggest that a MEKK cascade diverges to regulate effectors other than transcription factors.

Animals↗
PubMed1995

Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes.

The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.

Amino Acid Sequence↗
PubMed1994

G alpha 13 stimulates Na-H exchange.

Activity of the ubiquitous Na-H exchanger (NHE1) is regulated by a number of receptors with tyrosine kinase activity as well as by several classes of receptors coupled to heterotrimeric GTP-binding proteins. We previously demonstrated that the beta 2-adrenergic receptor and other receptors that stimulate adenylyl cyclase by activating Gs stimulate NHE1 by a guanine nucleotide-dependent mechanism that is independent of receptor coupling to Gs. Now we report that a recently identified G alpha subunit, alpha 13, activates the exchanger. Transient expression of mutationally activated alpha 13 constitutively stimulates Na-H exchange; moreover, an alpha 13/alpha z chimera, designed to respond to stimulation by Gi-coupled receptors, mediates stimulation of Na-H exchange by one such receptor, the dopamine2 receptor. Mutationally activated alpha 13, however, does not stimulate adenylyl cyclase activity or phosphoinositide hydrolysis, indicating that its action on NHE1 occurs independently of these two effector pathways. These findings reveal the first known signaling function of alpha 13 and identify a new G protein involved in the regulation of NHE1.

Amino Acid Sequence↗
PubMed1992

Aleurone nuclear proteins bind to similar elements in the promoter regions of two gibberellin-regulated alpha-amylase genes.

Binding of nuclear proteins from wild oat aleurone protoplasts to the promoter regions of two gibberellin-regulated wheat alpha-amylase genes (alpha-Amy1/18 and alpha-Amy2/54) has been studied by gel retardation and DNase 1 footprinting. Gel retardation studies using 300-430 bp fragments of the promoters showed similar binding characteristics with nuclear extracts from both gibberellin A1-treated and untreated protoplasts. DNase 1 footprints localised binding of nuclear proteins from gibberellin A1-treated aleurone protoplasts to regions in both promoters. Similar sequence elements in the promoter regions of both genes were protected from digestion although the location and number of footprints in each promoter region were different. Each footprint contained either a sequence similar to the cAMP and/or phorbol ester response elements, or a hyphenated palindrome sequence. The presence of cAMP and/or phorbol ester response element-like sequences in the footprints suggests that transcription factors of the bZIP type may be involved in the expression of alpha-amylase genes in aleurone cells. Footprints containing hyphenated palindrome sequences, found in the promoter regions of both genes, suggest the possible involvement of other classes of transcription factor. The conserved alpha-amylase promoter sequence TAA-CAGA was also shown to bind nuclear protein in the alpha-Amy2/54 promoter. These observations are discussed in relation to alpha-amylase gene expression in aleurone and to functional data concerning these genes.

Base Sequence↗
PubMed1992

cDNA cloning of a tetraubiquitin gene, and expression of ubiquitin-containing transcripts, in aleurone layers of Avena fatua.

A lambda gt 11 cDNA library, constructed from poly(A)+ mRNA isolated from Avena fatua aleurone layers incubated with 1 microM gibberellin A1 (GA1) for 4 days, was screened with an anti-idiotypic antiserum raised against the GA-specific monoclonal antibody MAC 182. One positive clone was isolated, sequenced and shown to encode a tetraubiquitin based on the deduced amino acid sequence. This polyubiquitin cDNA exhibited a high degree of homology to a cloned wheat hexaubiquitin in its 3'-non-coding region. Analysis of total RNA isolated from A. fatua aleurone layers, treated without or with a range of concentrations of GA1 from 10(-11) to 10(-6) M, by northern blotting using the cDNA probe revealed 8 different ubiquitin-containing transcript classes all of which are constitutively expressed in aleurone and are regulated by GA1.

Amino Acid Sequence↗
PubMed1992

Gibberellin perception and the Avena fatua aleurone: do our molecular keys fit the correct locks?

The plant hormones GA, ABA, and auxin differ from the majority of animal hormones in that they are hydrophobic weak acids. They are soluble in the inter- and intra-cellular environments of plant tissues and their neutral species can cross the plasma membrane by passive diffusion. Auxin transport is mediated by specific uptake and efflux carriers in plasma membranes, and there is some evidence for carrier-mediated uptake of GA and ABA. Because these plant hormones can cross the plasma membrane it is not a prerequisite that receptors for them should be at the protoplast surface. Nevertheless, there is substantial evidence that auxin acts at the plasma membrane, and evidence suggesting that GA may be perceived at the plasma membrane of A. fatua aleurone protoplasts has been reviewed here. It is conceivable that the plant plasma membrane might provide the means to integrate, transduce, and amplify these signals, and that such properties of the plasma membrane, rather than the permeability characteristics of these ligands, may determine the site of perception. Further progress in our understanding of signal transduction pathways that may be involved in the actions of plant hormones is likely to shed light on these questions. It has been proposed that GA receptors involved in cell elongation may be soluble rather than membrane bound. The soluble 50 kDa GA-binding protein observed in aleurone by GA4 photoaffinity labelling may be a good candidate for a soluble GA receptor.(ABSTRACT TRUNCATED AT 250 WORDS)

Antibodies, Anti-Idiotypic↗