PubMed Health⌕ Search

Biomedical subjects

R I Richards

Publications and source records attributed to R I Richards.

At least 19 recordsLinked to original sources
PubMed2004

Autosomal dominant congenital non-progressive ataxia overlaps with the SCA15 locus.

BACKGROUND: Most patients with pure nonprogressive congenital cerebellar ataxia have a sporadic form of unknown heredity and etiology. Several small families have been reported with a dominantly inherited nonprogressive congenital ataxia (NPCA). METHODS: The authors ascertained and clinically characterized a four-generation pedigree segregating an autosomal dominant type of congenital nonprogressive cerebellar ataxia associated with cognitive impairment. Following the exclusion of several SCA localizations (SCA-1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 17, IOSCA, and DRPLA), a genome-wide linkage study was performed. RESULTS: Examination of the family showed that all affected members had gait ataxia and cognitive disability with variable features of dysarthria, dysmetria, dysdiadochokinesia, nystagmus, dystonic movements, and cerebellar hypoplasia on imaging. Clinical signs of pyramidal tract dysfunction and sensory changes were absent. A genome-wide search in this family detected linkage to chromosome 3p with a maximum two-point lod score of 4.26 at D3S3630. This localization to the pter is distal to D3S1304, as defined by a recombination event. This overlaps with the SCA15 locus, with the critical overlapping region between the microsatellite markers, D3S1304 and D3S1620 (approximately 8 cM). CONCLUSION: Autosomal dominant congenital nonprogressive cerebellar ataxia with or without cerebellar hypoplasia overlaps with the SCA15 locus on chromosome 3pter.

Adolescent↗
PubMed2001

Dynamic mutations: a decade of unstable expanded repeats in human genetic disease.

The term 'dynamic mutation' was introduced to distinguish the unique properties of expanding, unstable DNA repeat sequences from other forms of mutation. The past decade has seen dynamic mutations uncovered as the molecular basis for a growing number of human genetic diseases and for all of the characterized 'rare' chromosomal fragile sites. The common properties of the repeats in different diseases and fragile sites have given insight into this unique form of DNA instability. While the dynamic mutation mechanism explains some unusual genetic characteristics, unexpected findings have raised new questions and challenged some assumptions about the pathways that lead from mutation to disease. This review will address the current understanding of the molecular mechanisms involved in the dynamic mutation process and elaborate on the pathogenic pathways that lead from expanded repeats to the diseases with which they are associated.

Genetic Diseases, Inborn↗
PubMed2001

A novel Q378X mutation exists in the transmembrane transporter protein ABCC6 and its pseudogene: implications for mutation analysis in pseudoxanthoma elasticum.

Pseudoxanthoma elasticum (PXE) is an inherited disorder of the elastic tissue with characteristic progressive calcification of elastic fibers in skin, eye, and the cardiovascular system. Recently mutations in the ABCC6 gene, encoding a transmembrane transporter protein, were identified as cause of the disease. Surprisingly, sequence and RFLP analysis for exon 9 with primers corresponding to flanking intronic sequence in diseased and haplotype negative members from all of our families and in a control population revealed either a homozygous or heterozygous state for the Q378X (1132C-->T) nonsense mutation in all individuals. With the publication of the genomic structure of the PXE locus we had identified the starting point of a large genomic segmental duplication within the locus in the cytogenetic interval defined by the Cy19 and Cy185 somatic cell hybrid breakpoints on chromosome 16p13.1. By means of somatic cell hybrid mapping we located this starting point telomeric to exon 10 of ABCC6. The duplication, however, does not include exon 10, but exons 1-9. These findings suggest that one or several copies of an ABCC6 pseudogene (psiABCC6) lie within this large segmental duplication. At least one copy contains exons 1-9 and maps to the chromosomal interval defined by the Cy163 and Cy11 breakpoints. Either this copy and/or an additional copy of psiABCC6 within Cy19-Cy183 carries the Q378X mutation that masks the correct identification of this nonsense mutation as being causative in pseudoxanthoma elasticum. Long-range PCR of exon 9 starting from sequence outside the genomic replication circumvents interference from the psiABCC6 DNA sequences and demonstrates that the Q378X mutation in the ABCC6 gene is associated with PXE in some families. These findings lead us to propose that gene conversion mechanisms from psiABCC6 to ABCC6 play a functional role in mutations causing PXE.

Alleles↗
PubMed2001

Fragile and unstable chromosomes in cancer: causes and consequences.

Cancer cells commonly exhibit various forms of genetic instability, such as changes in chromosome copy number, translocations and point mutations in particular genes. Although transmissible change seems to be an essential part of the neoplastic process, the extent to which DNA instability is a cause rather than a consequence of cancer is unclear. Chromosomal fragile sites have been proposed to be not only susceptible to DNA instability in cancer cells, but also associated with genes that contribute to the neoplastic process. Mutation at fragile site loci might therefore have a causative role in cancer. Recent studies on one class of human chromosomal fragile sites show that instability at fragile site loci can functionally contribute to tumor cell biology.

Animals↗
PubMed2000

Common chromosomal fragile site FRA16D sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells.

Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cyto-genetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.

Alternative Splicing↗
PubMed2000

Chromosomal fragile site FRA16D and DNA instability in cancer.

It has been proposed that common aphidicolin-inducible fragile sites, in general, predispose to specific chromosomal breakage associated with deletion, amplification, and/or translocation in certain forms of cancer. Although this appears to be the case for the fragile site FRA3B and may be the case for FRA7G, it is not yet clear whether this association is a general property of this class of fragile site. The major aim of the present study was to determine whether the FRA16D chromosomal fragile site locus has a role to play in predisposing DNA sequences within and adjacent to the fragile site to DNA instability (such as deletion or translocation), which could lead to or be associated with neoplasia. We report the localization of FRA16D within a contig of cloned DNA and demonstrate that this fragile site coincides with a region of homozygous deletion in a gastric adenocarcinoma cell line and is bracketed by translocation breakpoints in multiple myeloma, as reported previously (Chesi, M., et al., Blood, 91: 4457-4463, 1998). Therefore, given similar findings at the FRA3B and FRA7G fragile sites, it is likely that common aphidicolin-inducible fragile sites exhibit the general property of localized DNA instability in cancer cells.

Adenocarcinoma↗
PubMed2000

Analysis of replication timing at the FRA10B and FRA16B fragile site loci.

The molecular basis for the cytogenetic appearance of chromosomal fragile sites is not yet understood. Late replication and further delay of replication at fragile sites expressing alleles has been observed for FRAXA, FRAXE and FRA3B fragile site loci. We analysed the timing of replication at the FRA10B and FRA16B loci to determine whether late replication is a feature which is shared by all fragile sites and, therefore, is a necessary condition for chromosomal fragile site expression. The FRA10B locus was located in a transitional region between early and late zones of replication. Fragile and non-fragile alleles exhibit a similar replication pattern proximal to the repeat but fragile alleles are delayed relative to non-fragile ones on the distal side. Although fragility at FRA10B appears to be caused by expansion of an AT-rich repeat in the region, replication time near the repeat was similar in fragile and non-fragile alleles. The FRA16B locus was late replicating and appeared to replicate even later on fragile chromosomes. While these observations are compatible with the hypothesis that delayed replication may play a role in fragile site expression, they suggest that replication delay may not need to occur at the expanded repeat region itself in order to be permissive for fragility.

Alleles↗
PubMed1999

Detection of a novel missense mutation and second recurrent mutation in the CACNA1A gene in individuals with EA-2 and FHM.

Mutations in the brain specific P/Q type Ca2+ channel alpha1 subunit gene, CACNA1A, have been identified in three clinically distinct disorders, viz. episodic ataxia type 2 (EA-2), familial hemiplegic migraine (FHM) and spinocerebellar ataxia 6 (SCA6). For individuals with EA-2, the mutations described thus far are presumed to result in a truncated protein product. Several different missense mutations have been identified in patients with FHM. At least two of these mutations have been identified on two different chromosome 19p13 haplotypes and thus represent recurrent mutations. In the present study, we have screened several individuals for mutations in all 47 exons in the CACNA1A gene by single-strand conformation analysis. We have characterised a novel missense mutation, G5260A, in exon 32 in a family segregating for EA-2. The consequence of this mutation is an amino acid substitution at a highly conserved position within the CACNA1A gene. This represents the first point mutation not resulting in a proposed truncated protein. Furthermore, this mutation has been detected in a family member with mild clinical signs including only migraine. Additionally, a second previously identified recurrent muta tion, C2272T, in exon 16 has been discovered in a patient with FHM.

Amino Acid Sequence↗
PubMed1998

Fragile sites still breaking.

Rare fragile sites on chromosomes are the archetypal dynamic mutations. They involve large expansions of the microsatellite CCG or AT-rich minisatellites. The mutation process is an increase in repeat-unit number from within a normal range, through a premutation range, up to full mutation where the fragile site is expressed. Full mutations can inactivate genes and are regions of genomic instability. Common fragile sites, in particular, might have a role in oncogensis by facilitating gene inactivation through chromosomal deletion or amplification, but this requires further exploration. The mechanisms behind the changes that give rise to the cytogenetic manifestation of chromosomal fragility are now beginning to be understood.

Chromosome Fragile Sites↗
PubMed1998

FRA10B structure reveals common elements in repeat expansion and chromosomal fragile site genesis.

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich approximately 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded approximately 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

Alleles↗
PubMed1998

CAG repeat expansion in autosomal dominant familial spastic paraparesis: novel expansion in a subset of patients.

Autosomal dominant familial spastic paraplegia (FSP) is a genetically heterogeneous neurodegenerative disorder displaying anticipation for which three loci have been mapped to the chromosomal positions 14q11.2-q24.3 (SPG3), 2p21-p24 (SPG4) and 15q11.1 (SPG6). The repeat expansion detection (RED) method has been used to demonstrate expanded CAG repeats in some FSP families that map to SPG4. We analyzed 20 FSP families, including four for which there is evidence for linkage to SPG4, and found that in most cases the repeat expansion detected by RED is due to non-pathogenic expansions of the chromosome 18q21.1 SEF2-1 or 17q21.3 ERDA1 locus. Polymorphic expansions at SEF2-1 and ERDA1 appear frequent and may confound RED studies in the search for genes causing disorders demonstrating anticipation. In six FSP families, however, CAG repeat expansion was detected in a subset of affected and at-risk individuals that did not result from expansion of the SEF2-1 and ERDA1 loci. Overall, 11 of 37 (30%) of the FSP patients with a CAG/CTG repeat expansion are unaccounted for by the SEF2-1 and ERDA1 loci, compared with two of 23 (9%) of the unaffected at-risk individuals and none of 19 controls. In the majority of cases these novel expansions were shorter than those previously reported.

Basic Helix-Loop-Helix Leucine Zipper Transcriptio↗
PubMed1998

Construction of an approximately 700-kb transcript map around the familial Mediterranean fever locus on human chromosome 16p13.3.

We used a combination of cDNA selection, exon amplification, and computational prediction from genomic sequence to isolate transcribed sequences from genomic DNA surrounding the familial Mediterranean fever (FMF) locus. Eighty-seven kb of genomic DNA around D16S3370, a marker showing a high degree of linkage disequilibrium with FMF, was sequenced to completion, and the sequence annotated. A transcript map reflecting the minimal number of genes encoded within the approximately 700 kb of genomic DNA surrounding the FMF locus was assembled. This map consists of 27 genes with discreet messages detectable on Northerns, in addition to three olfactory-receptor genes, a cluster of 18 tRNA genes, and two putative transcriptional units that have typical intron-exon splice junctions yet do not detect messages on Northerns. Four of the transcripts are identical to genes described previously, seven have been independently identified by the French FMF Consortium, and the others are novel. Six related zinc-finger genes, a cluster of tRNAs, and three olfactory receptors account for the majority of transcribed sequences isolated from a 315-kb FMF central region (between D16S468/D16S3070 and cosmid 377A12). Interspersed among them are several genes that may be important in inflammation. This transcript map not only has permitted the identification of the FMF gene (MEFV), but also has provided us an opportunity to probe the structural and functional features of this region of chromosome 16.

Amino Acid Sequence↗
PubMed1997

Chromosomal localization of the human P2y6 purinoceptor gene and phylogenetic analysis of the P2y purinoceptor family.

The G-protein-coupled P2Y purinoceptors mediate a variety of physiological effects in response to extracellular nucleotides. With the recent discovery of several new members from a variety of species, the P2Y purinoceptor family now encompasses types P2Y1 to P2Y6. By fluorescence in situ hybridization and utilization of the National Center for Biotechnology Information (NCBI) database, the human P2Y6 gene was localized to chromosome 11q13.5, between polymorphic markers D11S1314 and D11S916. NCBI database analysis of the remaining human P2Y purinoceptor genes revealed that P2Y2 and P2Y6 mapped to within less than 4 cM, and thus constitute the first described chromosomal clustering of this gene family. Phylogenetic analysis of the P2Y purinoceptor family demonstrated the presence of five evolutionary branches and suggests the occurrence of an ancient gene duplication event.

Chromosome Mapping↗
PubMed1997

Unbalanced t(4;11)(q32;q23) in a 34-year-old man with manifestations of distal monosomy 11q and trisomy 4q syndromes.

We present a 34-year-old man with an unbalanced translocation between the long arms of chromosome 4 and chromosome 11. He had manifestations of monosomy 11(q23)--minor facial anomalies, abnormal head shape, cryptorchidism; trisomy 4(q32)--hirsutism, renal disease; and manifestations attributable to both imbalances--heart disease, musculoskeletal anomalies, and mental retardation. FISH studies showed that the chromosome 11q23.3 translocation breakpoint was distal to the rare folate sensitive fragile site (FRA11B). The patient is the oldest reported with both imbalance of 4q+ and 11q-.

Adult↗
PubMed1997

Construction of a 1-Mb restriction-mapped cosmid contig containing the candidate region for the familial Mediterranean fever locus (MEFV) on chromosome 16p 13.3.

In this paper we describe the assembly and restriction map of a 1.05-Mb cosmid contig spanning the candidate region for familial Mediterranean fever (FMF), a recessively inherited disorder of inflammation localized to 16p13.3. Using a combination of cosmid walking and screening for P1, PAC, BAC, and YAC clones, we have generated a contig of genomic clones spanning approximately 1050 kb that contains the FMF critical region. The map consists of 179 cosmid, 15 P1, 10 PAC, 3 BAC, and 17 YAC clones, anchored by 27 STS markers. Eight additional STSs have been developed from the approximately 700 kb immediately centromeric to this genomic region. Five of the 35 STSs are microsatellites that have not been previously reported. NotI and EcoRI mapping of the overlapping cosmids, hybridization of restriction fragments from cosmids to one another, and STS analyses have been used to validate the assembly of the contig. Our contig totally subsumes the 250-kb interval recently reported, by founder haplotype analysis, to contain the FMF gene. Thus, our high-resolution clone map provides an ideal resource for transcriptional mapping toward the eventual identification of this disease gene.

Base Sequence↗
PubMed1997

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat.

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Base Composition↗