PubMed Health⌕ Search

Biomedical subjects

R Ivell

Publications and source records attributed to R Ivell.

At least 37 records · Page 2Linked to original sources
PubMed2000

Mammalian mesotocin: cDNA sequence and expression of an oxytocin-like gene in a macropodid marsupial, the tammar wallaby.

The oxytocin (OT)-like peptide of most Australian marsupials is mesotocin (MT), which differs from OT by substitution of isoleucine for leucine at position 8. To date, the only information on the evolution of the OT peptide in marsupials is based on the sequence of the 9-amino acid peptide itself. The main objective of this study was to obtain the nucleotide and derived amino acid sequences of a marsupial MT precursor for comparison with known OT and MT precursors of eutherians and nonmammalian vertebrates. The structural organization and sequence of the MT gene and its specific transcript were established in a macropodid marsupial, the tammar wallaby, using PCR strategies with a combination of genomic DNA and reverse-transcribed hypothalamic RNA. A consensus genomic sequence of 1221 bp was produced which, by comparison with the expressed cDNA sequence, included two intron sequences of 480 and 188 bp. The tammar MT precursor molecule consists of a 32-amino acid signal peptide, followed by the MT-encoding region and the Gly-Lys-Arg carboxy-terminal cleavage and amidation signal which separates the nonapeptide from the 92-amino acid neurophysin. At the amino acid level, the MT precursor is more similar to eutherian OT precursors than to nonmammalian MT, isotocin, or vasotocin precursors. Northern analysis demonstrated a single transcript of approximately 0.6 kB in the hypothalamus. Mesotocin mRNA is also present in several tissues of the reproductive tract, including the corpus luteum, follicle, uterus, and placenta. Within the ovary, MT transcripts are localized predominantly in the granulosa cells of antral follicles with some positive hybridization signals in cells of the theca interna. This pattern of MT gene expression in marsupials is very similar to that of OT in eutherians and suggests a conserved physiology in the mammalian ovary.

Amino Acid Sequence↗
PubMed2000

Structure and expression of the mouse gene encoding the endozepine-like peptide from haploid male germ cells.

The endozepine-like peptide (ELP) represents a testis-specific isoform of the ubiquitous acyl-CoA binding protein (ACBP) and is highly expressed in late haploid stages of male germ cell development. The genomic sequence of the functional ELP gene as well as that of a pseudogene were analysed from independent bacteriophage clones of a 129sv mouse genomic library. Unlike the ACBP gene, which comprises four exons, the ELP gene has only a single intron within the region of the 5' untranslated region, suggesting that, like some other haploid expressed genes, the ELP gene might have evolved by retroposon-mediated gene duplication. Primer extension analysis was used to define the start site for transcription and hence the 5' promoter region. Electrophoretic mobility shift analysis was carried out on this region comparing nuclear extracts from adult mouse testis with those from mouse liver. Several testis-specific DNA-protein complexes were observed throughout 700 bp upstream of the transcription start site. One of these could be identified as corresponding to a steroidogenic factor-1 (SF-1) binding element. Further analysis using pure transcription factors showed that this element at position -340 was able to bind specifically to both SF-1 and to the germ cell nuclear factor (GCNF). Immunohistochemical analysis using an ELP-specific antibody showed that expression was very restricted within the testis to the postmeiotic germ cells, and in the ovary to interstitial/luteal cells, cell-types known to express GCNF and SF-1, respectively. Testes of CREM-tau knockout mice, lacking all spermatogenic stages later than round spermatids, were devoid of ELP immunoreactivity, whereas in RAD6 knockout mice the few remaining elongated spermatids were clearly defined by this excellent late haploid marker product. The ELP gene and its product thus offer an ideal system with which to investigate the differentiation of late haploid stages of spermatogenesis.

Animals↗
PubMed2000

Cloning and expression analysis of testis-specific cyclic 3', 5'-adenosine monophosphate-responsive element modulator activators in the nonhuman primate (Macaca fascicularis): comparison with other primate and rodent species.

The cAMP-responsive element modulator (CREM) gene encodes a transcription factor that is essential for spermatogenesis. In mouse testis, several CREM repressors and activators have been identified. In contrast to the situation for the mouse, however, little is known about CREM isoforms in the primate testis. We analyzed CREM isoforms and mRNA expression in a clinically relevant primate model, the cynomolgus monkey (Macaca fascicularis). A cDNA library was generated from monkey testis; and two activator isoforms (tau2 with and without exon gamma) were identified, which displayed high sequence identity to mouse and human isoforms. The insertion of exon gamma was observed for the first time in the primate testis. CREM activator expression was confined to the testis, where it was seen in late pachytene spermatocytes and round spermatids in specific spermatogenic stages, as revealed by in situ hybridization. Comparison of the mRNA and the recently described protein expression indicated a lack of translational delay of CREM expression. Comparative analysis of testicular CREM expression by reverse transcription-polymerase chain reaction yielded several transcripts in the rat, mouse, hamster, and marmoset; two transcripts in cynomolgus and rhesus monkeys; and one transcript in men. These findings suggest an evolutionary trend from multiple activator isoforms to a single activator transcript in men.

Amino Acid Sequence↗
PubMed2000

The rat endozepine-like peptide gene is highly expressed in late haploid stages of male germ cell development.

The structure of the endozepine-like peptide (ELP) gene is closely related to the intracellular acyl-CoA binding protein (ACBP), but unlike the generalized distribution of the latter, it is restricted to the male germ cells of the testis. In the present study, a combination of nonradioactive in situ mRNA hybridization and immunohistochemistry was used to precisely determine the cellular expression patterns of ELP mRNA and protein in control and methoxyacetic acid (MAA)-treated rat testes. ELP transcripts are first detectable in late stages (step 6) of round spermatids, with transcription increasing through late-elongating steps. Translation of the ELP mRNA is delayed, with first immunohistochemical staining occurring in elongated spermatids at step 16, and protein accumulating through step 19. ELP immunoreactivity proves to be an excellent marker for late spermatid stages and highlights the presumably clonal recovery of spermatids following MAA treatment.

Acetates↗
PubMed2000

Acute regulation of the bovine gene for the steroidogenic acute regulatory protein in ovarian theca and adrenocortical cells.

Upregulation of the steroidogenic acute regulatory protein (StAR) is implicated in the rapid synthesis and secretion of steroidogenic cells to produce steroids in response to stimulation by trophic hormones of the gonadal and stress axes. In the present study, we have assessed the kinetics of both StAR gene transcription and protein biosynthesis in primary cell cultures of bovine adrenocortical and ovarian theca cells, under conditions of acute stimulation by corticotrophin (ACTH) and luteinizing hormone (LH), respectively. In both cell systems, detectable upregulation of StAR gene transcription occurred within 1-2 h, reaching maxima at 4 h (theca cells) or 6 h (adrenocortical cells). mRNA levels returned rapidly to baseline, by 12 h or 24 h, respectively. Specific StAR protein levels were assessed by western blotting using a novel antibody raised against a bovine StAR peptide, and showed a similar fast upregulation, albeit delayed by 1-2 h compared with the mRNA. The response of the cultured theca cells was more acute than that of the adrenocortical cells, possibly reflecting the propensity of the LH receptor to desensitize rapidly, unlike the ACTH receptor. The primary bovine theca cell cultures were also used for fully homologous transfection studies using various deletion promoter-reporter constructs of the bovine StAR gene. Kinetic analysis of the results indicated that the acute transcriptional response resides within the proximal (-315 bp) promoter region, which includes two putative responsive elements for the steroidogenic factor-1. More distal promoter regions may be involved in modulating the specificity of expression by combining enhancer and inhibitory functions.

Adrenal Cortex↗
PubMed1999

Molecular cloning of a human MafF homologue, which specifically binds to the oxytocin receptor gene in term myometrium.

The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term, the US-2 element was used in a yeast one-hybrid system to screen a cDNA library derived from term human myometrium. Positive clones were further screened by electrophoretic mobility shift assay for their ability to bind the human OTR gene promoter, containing the US-2 motif. A 2.3-kb full-length cDNA encoding a human homologue of chicken MafF (hMafF) was isolated. hMafF represents an 18-kDa protein and contains an extended leucine zipper structure, but lacks a transactivation domain. Furthermore, Northern hybridization showed strong hMafF mRNA expression in the kidney and in term myometrium only, but not in nonpregnant myometrium. The hMafF protein is also preferentially expressed in term myometrium, as shown by specific binding to the OTR promoter. The highly specific binding of hMafF to the US-2 motif in the human OTR gene, together with its pattern of expression, supports a role for hMafF in OTR gene upregulation at term.

Amino Acid Sequence↗
PubMed1999

Rat endozepine-like peptide (ELP): cDNA cloning, genomic organization and tissue-specific expression.

A cDNA encoding the rat homolog of the previously characterized murine endozepine-like peptide (ELP) was isolated by a PCR cloning strategy. Sequence comparison with the murine cDNA sequence revealed a conservation of the ELP primary structure between both rodent species with minor amino acid exchanges. We investigated the genomic organization of the rat ELP gene by genomic PCR. This indicated the presence of a single short intron of 451bp interrupting the 5' untranslated region. Tissue-dependent ELP expression was determined by Northern hybridization and semiquantitative RT-PCR. Northern hybridization showed an ELP specific transcript in both the male and the female gonad, but the level of ovarian ELP transcription was considerably lower than in the testis. RT-PCR analysis demonstrated a low and varying level of ELP background expression in all examined tissues. In contrast to the closely related ACBP gene, ELP shows a different genomic organization and a more regulated expression pattern, and may exert a specific function as a gonadal acyl-CoA pool former and transporter.

5' Untranslated Regions↗
PubMed1999

Cloning of bovine estrogen receptor beta (ERbeta): expression of novel deleted isoforms in reproductive tissues.

cDNAs coding for bovine estrogen receptor beta (ERbeta) isoforms were cloned from bovine granulosa cells using a combination of several RT-PCR strategies. The cloned full-length receptor contains an open reading frame of 474 amino acids encoding a protein with high homology to the ERbeta sequences from other species. A second isoform nearly totally lacking the ligand binding domain was cloned that is expressed to relatively high levels in reproductive tissues. Expression of both ERbeta isoforms is down-regulated in corpus luteum and endometrium during the luteal phase of the female cycle. In addition, in granulosa cells several ERbeta isoforms carrying major internal deletions were detected by RT-PCR and cloned. Transient transfection studies expressing the two major bovine ERbeta isoforms together with an ERE reporter construct show estrogen-dependent transactivation by the full-length isoform, whereas the isoform lacking the ligand binding domain did not show any transactivation.

Amino Acid Sequence↗
PubMed1999

The role of sex steroids in the oxytocin hormone system.

The sex steroids and the peptide hormone oxytocin are both ancient modulators of the reproductive system of most metazoan species responsible for tissue differentiation and acute events respectively. In vivo experimentation implies estrogenic control of both the oxytocin (OT) gene and that for its receptor (OTR). Yet neither gene promoter appears able to bind classic estrogen-dependent nuclear receptors (ER) in vitro. The literature is confused by some transfected cell culture experiments which suggest that the human and rat OT gene promoter can be regulated by both ER alpha and ER beta through a major hormone response element at -160 bp upstream of the transcription start site. These findings depended, however, upon the presence of a high molar excess of the nuclear estrogen receptor. The current consensus suggests that the sex steroids are acting indirectly on both the OT and OTR genes, possibly involving intermediate transcription factors or cofactors. They may also act upon the OTR at the cell membrane, though more study is needed before the few current observations can be generalized. Due to the OT system being so ancient and fundamental to all aspects of reproduction, it is likely that the mechanisms by which the sex steroids influence this system are going to be of general importance to many other basic aspects of reproductive control.

Animals↗
PubMed1999

Differential protein-DNA binding analysis identifies a novel enhancer element, US-1, involved in the upregulation of the oxytocin receptor gene in human myometrium at term.

In order to investigate the regulatory mechanisms involved in the transcription of the human oxytocin receptor (OTR) gene in the human myometrium at term of pregnancy, we subjected the 5' flanking region of the gene to a differential EMSA (electrophoretic mobility shift assay) procedure. Comparing nuclear proteins from term myometrium, in which OTR gene transcription is massively up-regulated, with those from the non-pregnant myometrium, indicated a prominent DNA-protein complex using the former extract. The sequence of the protein binding site was determined within 20 bp (TCTGCCTTCATCCAGCC) and designated as uterine stimulator motif-1 (US-1). The concatemerized US-1 sequence exhibited enhancer activity using a minimal thymidine kinase promoter (tk-81) in transfected SKN cells. We partially purified US-1 binding protein from SKN cells using a resin bead affinity procedure. Binding activity could be concentrated, although the protein eluate still comprised more than 20 component polypeptides. The molecular weight of the principal protein-DNA complex was determined following UV crosslinking to be 70 kDa. In circumstances where a cell-line mimicking the pregnant uterus at term is not available, the differential EMSA strategy, comparing OTR DNA protein binding in up- and down-regulated tissues, provides a powerful tool to investigate OTR regulation in the uterus. However, the precise characterization and identity of the specific DNA-binding protein(s) and consequent experimental verification of regulatory mechanisms still require elucidation.

Base Sequence↗
PubMed1999

Structure and expression of the rat relaxin-like factor (RLF) gene.

The relaxin-like factor (RLF) is a novel member of the insulin-IGF-relaxin family of growth factors and hormones, and its mRNA is expressed very specifically in the Leydig cells of the testis and in the theca and luteal cells of the ovary. Here we report the cloning of the RLF gene and cDNA from the rat. The 0.8kb mRNA is produced from a small gene comprising two exons situated less than 1 kb downstream of the gene for the signalling factor JAK3. Northern hybridization confirms high RLF mRNA expression in the adult rat testis, and low expression in the ovary, but in no other tissues examined. Northern analysis of fetal and neonatal gonadal tissues showed that RLF mRNA is highly upregulated in the testes of day 19 embryos, but not in later neonatal stages, nor in any ovarian tissue from this period. This would indicate that RLF is a marker for the mature fetal as well as the adult-type Leydig cell, but is not expressed in premature, precursor, or dedifferentiated Leydig cells of either cell type. Finally, RNA was analysed from the testes of rats which had been treated with ethylene dimethane sulfonate (EDS), an alkylating agent that specifically destroys rat Leydig cells. RLF mRNA was absent from the acutely treated testes, but became detectable between 15 and 20 days post-treatment, concomitant with the repopulation of the testes by new Leydig cells. Continuous testosterone substitution of EDS-treated rats suppressed the production of gonadotropins, and LH-dependent Leydig cell differentiation, with the result that RLF mRNA remained undetectable throughout the study period. In conclusion, RLF is a very specific marker for the mature Leydig cell phenotype in both the adult-type and fetal Leydig cell populations of the rat testis.

Amino Acid Sequence↗
PubMed1999

Expression of relaxin-like factor is down-regulated in human testicular Leydig cell neoplasia.

In addition to their role in steroidogenesis in the male, testicular Leydig cells constitutively express large amounts of the peptide relaxin-like factor (RLF), also known as Ley-IL. The Leydig cell-derived RLF belongs to the insulin-like superfamily, which also includes relaxin, insulin and the insulin-like growth factors, and within the testis is a specific marker of Leydig cells. Little information is available either on the regulation of gene expression or on the function of this Leydig cell-derived peptide. In the present study we have investigated the expression pattern of human RLF in patients with rare Leydig cell hyperplasia and adenoma. The expression of both mRNA and protein appear to be decreased in hyperplastic Leydig cells, whereas in the Leydig cell adenomas studied, large central areas of the adenoma were devoid of RLF mRNA and protein. Only Leydig cells located at the periphery of the adenoma displayed expression of RLF, with full agreement between in-situ hybridization and immunohistochemistry. It thus appears that the expression of the RLF gene and its products are down-regulated in Leydig cell hyperplasia and adenoma, consistent with a concomitant dedifferentiation of these cells.

Adenoma↗
PubMed1999

Differential splicing and expression of the relaxin-like factor gene in reproductive tissues of the marmoset monkey (Callithrix jacchus).

The relaxin-like factor (RLF) is a novel member of the insulin/relaxin/insulin-like growth factor family of growth factors and hormones that is expressed predominantly in the reproductive system, with highest expression in the Leydig cells of the testis. Using a combination of molecular and immunological techniques, we have characterized the structure and expression of the RLF gene from a primate model, the marmoset monkey, with the intention of comparing this with recent results on the closely related hormone relaxin in this species. As in other species, including the human, RLF gene products can be detected maximally in Leydig cells and in the follicular theca interna cells and corpora lutea of the ovary. Reverse transcription-polymerase chain reaction analysis confirmed this expression and showed that in the corpus luteum, testis, and epididymis, a second, alternative RLF gene transcript was present that is expressed at low levels and that appears to be derived by differential splicing of a novel exon. Analysis of genomic DNA from the marmoset showed that in this species, the single-copy gene contains a longer intronic region separating the two exons described for the human. Alternative splicing introduces a novel exon 1A between exons 1 and 2, which leads to an altered open reading frame, with a new stop codon, such that if translated, the novel transcript will encode a truncated polypeptide comprising a C-terminally extended B-domain.

Alternative Splicing↗
PubMed1999

Identification of markers for precursor and leydig cell differentiation in the adult rat testis following ethane dimethyl sulphonate administration.

Administration of ethane dimethane sulphonate (EDS) to adult rats results in the destruction of all Leydig cells, followed by a complete regeneration. We investigated this regeneration process in more detail, using different markers for precursor and developing Leydig cells: the LH receptor, 3beta-hydroxysteroid dehydrogenase (3beta-HSD), transforming growth factor alpha (TGFalpha), and a new marker for Leydig cell maturation, relaxin-like factor (RLF). LH receptor immunoreactivity was found in Leydig cell-depleted testes at 3 and 8 days after EDS administration. The positive (precursor) cells had a mesenchymal-like morphology. The number of LH receptor-positive cells 8 days after EDS administration was 15 +/- 4 per 500 Sertoli cell nuclei. Fifteen days after EDS administration, the first new Leydig cells could be observed. These cells stained positively with both the antibodies against the LH receptor and 3beta-HSD, while some cells also stained positively for TGFalpha. After EDS administration, RLF mRNA disappeared from the testis and reappeared again at the time of the appearance of the first Leydig cells. Concomitant with the increase in the number of Leydig cells, the number of RLF-expressing cells increased. The observations of the present study give further support to the hypothesis that Leydig cell development in the prepubertal testis, and in the adult testis following EDS administration, takes place along the same cell lineage and suggest, therefore, that the adult EDS-treated rat can serve as a model for studying the adult-type Leydig cell development that normally occurs in the prepubertal rat testis.

3-Hydroxysteroid Dehydrogenases↗
PubMed1999

Relaxin in the marmoset monkey: secretion pattern in the ovarian cycle and early pregnancy.

Relaxin is a peptide hormone with a broad range of biological activities, related not only to parturition and lactation but possibly also to decidualization, implantation, and early pregnancy. The present study was designed to investigate the secretion pattern of relaxin throughout the cycle and early pregnancy in the common marmoset monkey in relation to ovarian function and the systemic hormone milieu. First, a novel relaxin ELISA was developed and validated to confirm the pattern of relaxin secretion during pregnancy. Secondly, serum relaxin profiles were determined through nonconceptive and conceptive cycles and analyzed in relation to the concentration of other hormones and to the development of ovarian follicles and corpora lutea (CL). Blood samples were collected 2-3 times per week from the experimental animals and analyzed for relaxin, progesterone, and LH. The animals from the conceptive cycles were also ultrascanned at these time points to determine the ovarian status up to Day 25 of pregnancy. During early pregnancy, the relaxin levels in serum were approximately 1 ng/ml, increasing up to 15 ng/ml in the second trimester, at a time when progesterone levels had declined. In the third trimester, when progesterone levels were increasing again, the levels of relaxin decreased, returning to basal levels by term of pregnancy. In early pregnancy there was a parallel increase in both relaxin and LH/hCG, with the relaxin rise in the conceptive cycle appearing sooner than in the nonconceptive cycle, suggesting that, like chorionic gonadotropin (CG), relaxin may be a useful and early marker for pregnancy. Unlike the situation in the human, there was no correlation between the levels of either hormone and the number of CL detected, infants born, mother's age, or parity. Relaxin levels increased in early pregnancy before bioactive LH/CG, implying that relaxin is not directly regulated by this gonadotropin. Furthermore, hCG applied to nonconceptive females during the expected time of implantation caused an increase in progesterone but not in relaxin concentrations. In summary, the results obtained indicate that relaxin may be a reliable indicator of early pregnancy status in the common marmoset, but it is independent of direct CG influence.

Animals↗