Biomedical subjects

R Koller

Publications and source records attributed to R Koller.

At least 55 records · Page 3Linked to original sources

PubMed1996

[sensorimotor differentiated reconstruction of peripheral nerves--a methods of intraoperative identification of motor fascicles].

In 1975, Freilinger et al. identified motor fibres by acetylcholinesterase (AChE) histochemistry. Precise identification of motor fascicles in cases of mixed peripheral nerve dissection became possible, and selective fascicular nerve repair could be performed. Using this technique, two separate operations were necessary for definitive nerve repair, since histochemical analysis took 28 hours. A modified AChE staining technique now offers results within one hour. In seven cases of human median and three cases of human ulnar nerve lesions, nerve biopsies were obtained and underwent both modified and standard histochemical staining. The standard procedure did not render any further information about the AChE activity indicating that both methods are equally reliable. Photomicrographs of the nerve specimen with motor fascicles marked on them were completed in all cases of the modified AChE staining method one hour after obtaining the biopsies. Intraoperative identification of motor fascicles by rapid AChE staining technique was performed in two cases of acute injuries of the median nerve, radial artery and musculotendineous system of the forearm. Biopsies were obtained at the beginning of the operation. Histochemical analysis was done while tendons and arteries were reconstructed and selective fascicular nerve repair was possible at the end of the operation. The rapid AChE staining may be applied intraoperatively to acute nerve injury and late peripheral nerve reconstruction provided the nerve is expected to already contain segregated motor fascicles.

Acetylcholinesterase↗

PubMed1996

[Analysis of change in finger function after flexor tenolysis].

39 fingers in 31 patients were examined on the average of 117,6 months after flexor tenolysis of the finger. Results were classified according to Millesi's scheme and compared to the preoperative situation. For control, the criteria according to Buck-Gramcko were applied as well. In 23 fingers tenolysis resulted in an improved function, 13 cases remained unchanged and three cases were seen worse than before tenolysis. The number of improved fingers, the gradual improvement and the final result depended upon the affected finger and the primary operation which proceeded tenolysis. Best results were obtained in the thumb and after primary tendon repair. The results which were classified according to Millesi's scheme showed a highly significant correlation to those according to Buck-Gramcko's classification.

Adult↗

PubMed1995

Prognostic factors in adenocarcinoma of the cardia.

BACKGROUND: The optimal extent of resection for adenocarcinomas of the gastroesophageal junction is controversial. This study was conducted to examine whether the extent of resection is an independent prognostic factor in cardia cancer. METHODS: The records and survival data of 125 patients who underwent resection for cancer of the cardia were retrospectively analyzed. Multiple regression was used to evaluate prognostic factors in patients who underwent proximal gastric resection (PR) or total gastrectomy (TG) for cancer of the cardia. RESULTS: Seventy-five patients underwent PR and 50 TG. The 5-year survival was 40% for tumors confined to the esophageal wall (T1, T2), and 13% in more advanced cases (T1, T2; P = 0.0001). Twenty-two percent of the patients with tumor-free margins, 10% of those with microscopic residual tumor, and none with macroscopic residual tumor survived longer than 5 years (P = 0.0001 for any residual tumor versus no residual tumor). Lymph node involvement (P = 0.002) and stage (P = 0.0001) were also significant in the univariate analysis. Five-year survival was 18% after TG, and 17% after PR (P = NS). CONCLUSION: Multiple regression identified residual tumor and penetration depth as independent predictors of survival (P = 0.0002, and P = 0.0001, respectively). After correction for these factors, none of the following variables were of additional significance: extent of resection (TG versus PR), lymph node involvement, age, or Lauren's classification. In 19 of 20 cases with microscopic incomplete resection, it was the oral margin that was positive. We conclude that the extent of resection (TG versus PR) does not influence survival in adenocarcinoma of the gastroesophageal junction.

Adenocarcinoma↗

PubMed1995

[Results of various reconstructive methods after subcutaneous mastectomy and objective evaluation of tissue fibrosis with a new measurement procedure].

Of 35 patients undergoing subcutaneous mastectomy performed within the last 15 years, 25 were evaluated for follow-up studies. Reconstruction had been achieved either using silicone implants or autologous tissue formed from the resulting dermal-fat pedicles. The patients were interviewed for subjective results. In addition, firmness of the breast according to the classification of Baker was investigated. The compressibility of the breast was electronically measured, employing a new compression device. In 13 patients, the breast was distorted after reconstruction with implants. The deformity did not correlate with submuscular or subcutaneous placement of the implants. The aesthetic results after dermal-fat pedicle techniques were superior to reconstruction with silicone implants. Compressibility to 32% of breast diameter was defined to be a border value between a soft and firmer breast, correlating with clinical conditions between Baker 2 and Baker 3.

Adult↗

PubMed1995

[Which changes occur in nerve grafts harvested with a nerve stripper? Morphological studies].

A histological and morphometric study was undertaken in order to evaluate the alterations in sural nerves harvested for nerve grafting using a nerve stripper. In 19 nerves biopsies were taken from the proximal and/or the distal end of the stripped nerve graft. Cross sections were examined for alterations of the perineurium and the myelin sheaths. In four nerves alterations within the perineurium were found, which affected 37% of the endoneural cross-sectional area on the average. In all specimens, the perineurial sheath was seen to be intact. The results of the present study suggest that harvesting of a nerve graft using a stripper does not cause major injuries to the graft and therefore successful neurotization of the graft should not be impaired.

Humans↗

PubMed1995

Monitoring of FES-induced muscle activity by continuous EMG-recording.

Functional Electrical Stimulation (FES) requires information on the stimulated muscle for adjustment of the stimulation current, avoidance of muscle fatigue during the conditioning period and long term follow-up. Several applications of chronical FES are in clinical practice, but a system for direct registration of muscle activity under FES still does not exist. In six sheep the right Latissimus Dorsi Muscle (LDM) and Thoracodorsal Nerve were exposed. Stimulation electrodes were applied to each nerve and 3 EMG-applied sensing electrodes were placed into each LDM. The LDM tendon was connected to a force transducer. Burst stimulation was applied and the amplitude was increased from 0 to 4 mA in steps from burst to burst. EMG (M-wave) was amplified and recorded continuously via modified instrumentation amplifier, oscilloscope and tape recorder. Isometric muscle tension was recorded using force transducer, A/D interface and PC. Continuous EMG-recording was performed in all cases. Simultaneous recording of muscle tension and EMG revealed a close correlation (IrI=0.95, p < 0.0001) between the muscle strength and amplitude of the M-wave. Continuous recording of the EMG seems to be a reliable method for direct monitoring of the stimulated muscle. Three intramuscular electrodes can provide enough information to monitor FES induced muscle activity.

Animals↗

PubMed1994

Experimental in situ conditioning of the latissimus dorsi muscle for circulatory assist by multichannel stimulation.

This study was undertaken to survey the changes in force and fatigue of the latissimus dorsi muscle during transformation into a fatigue-resistant muscle by indirect or nervous multichannel stimulation. In sheep, a silicone chamber connected to a pressure-transducing system was implanted under the left latissimus dorsi muscle. Muscle conditioning was performed by multichannel (carousel) stimulation of the thoracodorsal nerve. The program was started with active periods of 10 min/h producing 10 tetanic contractions/min. It was increased until 70 contractions/min could be performed during 24 h. The changes of muscle force and fatigue were monitored by the silicone balloon system. After a mean period of 22 weeks, fatigue resistance was reached. The fatigue-resistant muscle was able to produce a pressure of about 100 mm Hg in the balloon. After finishing the conditioning procedure, muscle forces and the fatigue resistance of the conditioned muscle were evaluated. The conditioned muscle showed only a minimal decrease of force during 20 min. Under a preload of 20 N, it exhibited a maximum tetanic tension of 95 N.

Animals↗

PubMed1994

Different abilities of Friend murine leukemia virus (MuLV) and Moloney MuLV to induce promonocytic leukemia are due to determinants in both psi-gag-PR and env regions.

Moloney murine leukemia virus (M-MuLV) is capable of inducing promonocytic leukemia in 50% of adult BALB/c mice that have received peritoneal injections of pristane, but Friend MuLV strain 57 (F-MuLV) is nonleukemogenic under similar conditions. It was shown earlier that these differences could not be mapped to the U3 region of the virus long terminal repeat, indicating the probable influence of structural genes and/or R-U5 sequences. In this study, reciprocal chimeras containing exchanged structural genes and R-U5 sequences from these two closely related viruses were analyzed for differences in ability to induce disease. Results showed that two regions of F-MuLV, psi-gag-PR and env, when substituted for those of M-MuLV were dramatically disease attenuating. The 5'-most region, which is widely distributed, overlaps with the 5' end of the env intron and includes the RNA packaging region, psi, the entire gag coding region, and the viral protease coding region (PR) of pol. It was also found that reciprocal constructs having substitutions of both of these regions of M-MuLV in an F-MuLV background allowed full reestablishment of promonocytic leukemia. These leukemias were positive for c-myb rearrangements which are characteristic of M-MuLV-induced promonocytic leukemias. Neither region alone, however, was sufficient to produce disease with a greater incidence than 13%. Further studies demonstrated that the inability of viruses with psi, gag, PR, or env sequences from F-MuLV to induce leukemia in this model system was not due to their inability to replicate in hematopoietic tissue, to integrate into the c-myb locus early on after infection in vivo, or to express gag-myb mRNA characteristic of M-MuLV-induced preleukemic cells and acute leukemia.

3T3 Cells↗

PubMed1993

Fiber regeneration in nerve grafts without connection to a target muscle: an experimental study in rabbits.

In 30 rabbits, both saphenous nerves were harvested as autografts and coapted to the branch for the rectus femoris muscle without connection to any distal target muscle. The graft from the right thigh was led to the contralateral extremity (crossover grafting). The graft on the left side remained on the same extremity (ipsilateral grafting). Animals were separated into four groups and were sacrificed 3, 6, 9, and 12 months after grafting. Specimens of the grafts and the donor motor branches were harvested for histomorphometric examination. The number of myelinated nerve fibers in the distal end of the nerve grafts was significantly increasing from 3 to 6 months after grafting and remained on a relatively constant level in the long-term groups. Three months after the first operation, greater numbers of myelinated nerve fibers were counted after ipsilateral grafting than after crossover grafting. In the long-term groups, this difference could not be observed.

Animals↗

PubMed1993

The mitochondrial tricarboxylate carrier.

The tricarboxylate carrier has recently been purified from rat liver mitochondria by three distinct scientific groups using different methods. A 37-38-kDa protein has been prepared by silca gel 60 chromatography by our group (Claeys and Azzi, 1989; Glerum et al., 1990). The specific citrate transport activity of this preparation is not significantly different from that measured in mitochondria and it is inhibitable by 1,2,3-benzenetricarboxylic acid. Bisaccia et al. (1990) have reported the isolation of a 30-kDa protein by Celite 535 chromatography, and Kaplan's group (Kaplan et al., 1990) have isolated a 32.5-kDa protein by Matrex Orange, Matrex Blue, and Affi-Gel chromatography. Peptide mapping has failed to support any structural homologies between the 37-38-kDa and the 30-32.5-kD proteins. The 38-kD protein is N-terminally blocked. The peptides obtained by several cleavage procedures have been partially sequenced. Their sequence information has been used to obtain different cDNA clones by a dual approach, the polymerase chain reaction and screening of a lambda ZAP cDNA library. The largest cDNA which could be isolated is 2,986 bp in length and contains a 1071-bp-long open reading frame and an unusually long 3' untranslated region, both of which have been completely sequenced. The protein sequence of the carrier from the first in-frame methionine is 322 amino acids in length and exhibits a molecular mass of 35,546. Comparison of the protein sequence to the sequences of the four members of the mitochondrial carrier protein family (ADP/ATP carrier, phosphate carrier, 2-oxoglutarate/malate carrier, and uncoupling protein) does not reveal significant similarity (cf. Walker et al., 1987). A tripartite internal homology, which is a characteristic of these proteins, is not present in the sequence of the tricarboxylate carrier protein. The mRNA for the tricarboxylate carrier is expressed in rat liver and brain, but not in rat heart.

Amino Acid Sequence↗

PubMed1993

[Relations between donor nerve size and degree of neurotization in the nerve transplant--an experimental study].

The present study was undertaken to investigate whether the number of myelinated fibers in a sensory nerve used as an autograft influences the result of nerve fiber regeneration in the graft. In 30 rabbits, the left saphenous nerve was used as an autograft. It was coapted to the motor branch to the rectus femoris muscle. Biopsies from both ends of the graft were taken. Animals were separated into four investigation groups, which were reexamined 3, 6, 9 and 12 months after the grafting procedure. Biopsies for histological and morphometric examination were again taken from the proximal and the distal part of the grafts. Thus, the number of myelinated nerve fibers in the different specimens could be obtained by computer-assisted image analysis. At the proximal end of the original saphenous nerve, the number of fibers varied between 1032 and 3100 (mean 2145). Corresponding data obtained from the distal end ranged from 1044 to 3084 myelinated nerve fibers (mean 1724). Fiber numbers in the proximal and distal parts of the grafts before and after regeneration were correlated to each other. In the whole population of specimens (correlation coefficient +/-0) as well as in the experimental subgroups, the quantitative success of neurotization in the grafts did not depend to a high degree upon the fiber numbers in the original saphenous nerve. The correlation coefficient for the proximal part of the graft exceeded 0.5 to only three and twelve months after grafting, but did not reach a level of statistical significance. In the distal part of the graft, the coefficient for a linear correlation was always less than 0.45.

Animals↗

PubMed1992

[Is premedication in gastroscopy hazardous?].

Premedication for gastroscopies is still controversial. Most gastroenterologists use premedication routinely, often without control of vital signs. However, even if rarely, serious (mainly cardiorespiratory) complications still occur. In 101 patients in whom a gastroscopy had been performed, oxygen saturation before, during and after the endoscopy was investigated. A fall in saturation was seen in most of the patients but was usually minor. However, severe hypoxemia occurred in some patients, especially if premedication was used. Older patients and patients with severe anemia were particularly at risk. These results emphasize that premedication should not be used without precaution and special surveillance, especially in high risk patients. Prophylactic oxygen administration significantly diminishes the risk.

Age Factors↗

PubMed1992

Time course of histomorphometric alterations in nerve grafts without connection to a muscle target organ: an experimental study in sheep.

In 15 adult sheep, the saphenous nerve (28 +/- 1.8 cm) was used for ipsilateral or for cross-nerve grafting and was sutured to the proximal stump of the cut, motor-nerve branch of the vastus muscle. The distal end of the nerve graft was left without a target organ. Semi-thin cross sections of normal vastus nerves and saphenous grafts and of the distal ends of the grafts were analyzed by computer-assisted planimetry, 3, 6, 9, 12, and 18 months after the nerve-grafting procedure. Electronmicroscopy was also performed on specimens from the distal ends of the nerve grafts. Comparing the total number of myelinated nerve fibers in the distal end of the graft, the ipsilateral group showed an increase with time elapsed since nerve grafting, while the cross-over group showed a maximum after 3 and 6 months, and fewer fibers after longer periods of regeneration. Independent of the time passed since nerve grafting, the diameters of the myelinated nerve fibers were homogeneously thin in both experimental groups. Most interesting, the cross-nerve grafts did more poorly than the ipsilateral ones, even before they were influenced by the target muscle. With ultrastructural investigation, the ends of the grafts containing only a few myelinated fibers also showed a low number of unmyelinated fibers, but an increase of collagen fibers. The results have consequences for the clinical application of cross-nerve grafting.

Animals↗

PubMed1992

Long-term results of nervous tissue alterations caused by epineurial electrode application: an experimental study in rat sciatic nerve.

In order to evaluate the long-term effects of epineurial electrode application for functional electrical stimulation (FES) the left sciatic nerve of seven rats was exposed. Four ring-shaped stainless steel wire electrodes were sutured to the epineurium of each nerve in the same manner as performed clinically for carrousel stimulation in man. The nerves were reexposed 1 year after implantation and the stimulation threshold to obtain a tetanic contraction in the lower limb was determined for each electrode. Afterwards the animals were sacrificed. The electrodes were excised and cross sections of the sciatic nerve directly at site of the electrodes, 2-mm proximal and 2-mm distal to them were harvested for histologic and planimetric assessment of nerve lesions. The area of damaged neural tissue was expressed as a percentage of the total cross-sectional area within the perineural sheath. The sciatic nerves of the right side served as controls. The values for the stimulation thresholds ranged between 0.1 and 1.0 mA (mean 0.43 mA). By morphometric examination five of seven nerves were seen altered, the altered areas captured between 1% and 4.8% of the total cross-sectional area of the nerves within the perineural sheath. Besides two specimens, all altered nerve segments exhibited distinct signs of nerve fiber regeneration. The clinical implications of the results for long-term electrical stimulation, such as phrenic pacing, are discussed.

Animals↗

PubMed1991

Acute myeloid leukemia induction by amphotropic murine retrovirus (4070A): clonal integrations involve c-myb in some but not all leukemias.

Amphotropic murine retrovirus 4070A was demonstrated to be highly leukemogenic when inoculated intravenously into adult DBA/2 mice that were undergoing an intense chronic inflammatory response, but was nonleukemogenic in the absence of inflammation. The virus-induced promoonocytic leukemias, designated AMPH-ML, are similar morphologically and in cell surface marker expression to monocytic leukemias, called MML and MF-ML, previously shown to be induced by Moloney murine leukemia virus and MF-3 virus (a recombinant between Friend murine leukemia virus and Moloney murine leukemia virus) and resemble certain mature acute monocytic leukemias in humans (AML subtype M5). Approximately two-thirds of the AMPH-MLs (subgroup I) were demonstrated to have alterations in the 5' end of the c-myb locus, an event which occurs in 100% of MML and MF-ML. Data indicate that proviral insertions in AMPH-ML subgroup I resulted in aberrant c-myb mRNA expression and truncation of its translation product at the amino terminus. Approximately one-third of the AMPH-MLs (subgroup II) had not undergone any DNA rearrangements at the c-myb locus. In addition, their transcripts and protein products were of normal size. These latter leukemias also had not undergone DNA rearrangements in c-myc, although retroviruses expressing myc have previously been shown to induce monocyte-macrophage tumors in mice undergoing a chronic inflammation. That subgroup II leukemias had at least one clonal viral insertion suggests that there may be other sites in the cellular genome that can be activated by insertional mutagenesis in these murine acute monocytic leukemias.

Animals↗

PubMed1991

Axon typing of rat muscle nerves using a double staining procedure for cholinesterase and carbonic anhydrase.

We developed a method for detecting activity of axonal cholinesterase (CE) and carbonic anhydrase (CA)--markers for motor and sensory nerve fibers (NFs)--in the same histological section. To reach this goal, cross-sections of muscle nerves were sequentially incubated with the standard protocols for CE and CA histochemistry. A modified incubation medium was used for CA in which Co++ is replaced by Ni++. This avoids interference of the two histochemical reactions because Co++ binds unspecifically to the brown copper-ferroferricyanide complex representing CE activity, whereas Ni++ does not. Cross-sections of the trapezius muscle nerve containing efferent and afferent NFs in segregated fascicles showed that CE activity was confined to motor NFs. Axonal CA was detected solely in sensory NFs. The number of labeled motor and sensory NFs determined in serial cross-sections stained with either the new or the conventional technique was not significantly different. Morphometric analysis revealed that small unreactive NFs (diameter less than 5 microns) are afferent, medium-sized ones (5 microns less than d less than 7 microns) are unclassifiable, and large ones (d greater than 7 microns) are efferent. The heterogenous CE activity of thick (alpha) motor NFs is linked to the type of their motor units. "Fast" motor units contain CE reactive NFs; "slow" ones have CE negative neurites.

Animals↗

PubMed1991

Histological assessment of nerve lesions caused by epineurial electrode application in rat sciatic nerve.

The left sciatic nerve of 36 rats was exposed and four ring-shaped stainless steel wire electrodes were sutured to the epineurium of each nerve in the same manner as performed clinically for "carousel stimulation" in man. The rats were sacrificed 10 days (Group 1), 3 weeks (Group 2), or 3 months (Group 3) after implantation. The electrodes were excised, the nerves were embedded in Epon, and semithin sections were obtained for histological and planimetric assessment of lesions caused by the epineurially sutured electrodes. The right sciatic nerves served as controls. The total area of neural tissue within the perineurium was determined at three levels: at the site of the electrodes, 8 mm proximal, and 8 mm distal. The area of neural tissue damaged by the surgical procedure was expressed as a percentage of the total area. In Group 1, nine of 12 nerves showed lesions ranging from 0.39% to 25.39% of the total area of neural tissue, in Group 2 eight of 11 sciatic nerves showed lesions ranging from 0.24% to 13.03% of the total area, and in Group 3 five of 12 nerves showed lesions ranging from 0.21% to 4.96% of the total area. The pathologically altered areas in Groups 2 and 3 exhibited distinct signs of nerve fiber regeneration. The reasons for the decrease in damage from Group 1 to Group 3 and the clinical implications of the results for long-term electrical stimulation are discussed.

Animals↗

PubMed1990

Transcriptional regulatory elements of the RAS2 gene of Saccharomyces cerevisiae.

We have analyzed a series of 5' deletions of the RAS2 gene to investigate its complex transcriptional regulation in the yeast Saccharomyces cerevisiae. Two positive transcriptional regulatory elements were identified. Element A regulates two of the three clusters of RAS2 transcripts. This element is capable of activating a heterologous promoter and contains two copies of the sequence CCTCGCCCC. Although one copy is sufficient for partial transcriptional activation, both copies are required for maximal RAS2 induction. Deletion of one copy resulted in a reduced level of RAS2 mRNA, selective loss of cluster II transcripts and reduced ability to activate the heterologous CYC1 promoter. Each of the 9 bp C rich repeats of element A is part of a sequence with extensive homology to a transcriptional regulatory element upstream of the human epidermal growth factor receptor (EGFR) gene. Element B contains a tandem duplication of a 21 nucleotide sequence TACATATATATATATCTTAG and activates cluster I RAS2 transcripts in the absence of Element A. The physiological role of these deletions was determined by assaying their ability to support growth on a nonfermentable carbon source. RAS2 promoter deletions containing either element A or B were able to overcome this growth defect characteristic of ras2 mutants cells. Deletion of both elements resulted in an insufficient amount of RAS2 protein for growth on a non-fermentable carbon source.

Base Sequence↗