PubMed Health⌕ Search

Biomedical subjects

R M MacKay

Publications and source records attributed to R M MacKay.

12 recordsLinked to original sources

Molecular cloning of three cDNAs that encode cysteine proteinases in the digestive gland of the American lobster (Homarus americanus).

Three clones were isolated from a lobster digestive gland cDNA library, using oligonucleotide probes based on the partial amino terminal sequence of a digestive cysteine proteinase. The cDNAs, LCP1, LCP2 and LCP3 encode preproenzymes of 322, 323 and 321 amino acid residues, and putative mature enzymes of 217, 216 and 215 residues, respectively. Calculated mature protein molecular masses are 23386 (LCP1), 29093 (LCP2) and 23255 (LCP3) Sequence alignments show that the lobster enzymes are more similar to L (55-62% identity) than H (42-44%) or B (22-24%) cathepsins. Southern analysis indicated as many as eleven genes related to the three cDNAs.

Animals↗

Beta-tubulins are encoded by at least four genes in the brown alga Ectocarpus variabilis.

Complementary DNA clones of two mRNA species that encode beta-tubulin in the brown alga Ectocarpus variabilis have been isolated. Sequence analysis revealed that the encoded proteins are very similar in primary structure to homologues in other eukaryotes, and differ from each other at six of 447 amino acid residues. The beta 6 message shows a preference for C- or G-terminated codons, using only 49 codons. The beta 5 message has a lesser codon bias, and makes a minor contribution to the beta-tubulin mRNA pool. Southern analysis of E. variabilis DNA demonstrated a beta-tubulin gene family of at least four members.

Amino Acid Sequence↗

Bacillus subtilis beta-1,4-endoglucanase products from intact and truncated genes are secreted into the extracellular medium by Escherichia coli.

We compared the secretion of a Bacillus subtilis endo-beta-1,4-glucanase (EC 3.2.1.4) in B. subtilis and of the product from the cloned gene (pC6.3) expressed in Escherichia coli. The cloned enzyme has been isolated previously as the 52.2-kilodalton (kDa) species predicted from the gene sequence (R. M. MacKay, A. Lo, G. Willick, M. Zuker, S. Baird, M. Dove, F. Moranelli, and V. Seligy, Nucleic Acids Res., 14:9159-9170, 1986); this 52.2-kDa species is then converted to an active 35.8-kDa species. The 35.8-kDa species has a segment removed from the COOH terminus. Endoglucanase products were identified by use of an antibody directed to the 35.8-kDa enzyme. Time course studies of the secretion in B. subtilis showed that the enzyme was first secreted as a 52.2-kDa proenzyme. This was cleaved progressively to a product of about 32 kDa. Time course analysis of the expression of the cloned product from pC6.3 in E. coli showed that about 70% of the endoglucanase activity was found extracellularly. Analysis of active products from three deletion clones showed that the expression pattern of the endoglucanase was not affected by removal of the transcription termination signal and that neither expression nor secretion was substantially altered by removal of a region coding for up to 163 residues of the carboxyl terminus.

Bacillus subtilis↗

Structure of a Bacillus subtilis endo-beta-1,4-glucanase gene.

The nucleotide sequence of the portion of a Bacillus subtilis (strain PAP115) 3 kb Pst I fragment which contains an endo-beta-1, 4-glucanase gene has been determined. This gene encodes a protein of 499 amino acid residues (Mr = 55,234) with a typical B. subtilis signal peptide. Escherichia coli which has been transformed with this gene produces an extracellular endoglucanase with an amino-terminus corresponding to the thirtieth encoded amino acid residue. The gene is preceded by a cryptic reading frame with a rho-independent terminator structure, and itself has such a structure in the immediate 3'-flanking region. We have also identified, in the 5'-flanking region, nucleotide sequences which resemble promoter elements recognized by Bacillus RNA polymerase E sigma 43. Comparison of the encoded amino acid sequence to other known beta-glucanases reveals a small region of similarity to the encoded protein of the Clostridium thermocellum celB gene. These similar regions may contain substrate-binding and/or catalytic sites.

Amino Acid Sequence↗

A clone coding for Schizophyllum commune beta-glucosidase: homology with a yeast beta-glucosidase.

Three identical clones coding for a partial sequence of the Schizophyllum commune beta-glucosidase were isolated from a cDNA library in lambda gt11, using polyclonal antibody to the enzyme. The identity was confirmed by comparison of the amino-terminus of a peptide from a protease lys-C digest with the sequence inferred from the cDNA sequence. A comparison of the sequence with that reported for a beta-glucosidase from Candida pelliculosa revealed a region in the latter with 43% identity in amino acid sequence. There was also a similarity in the S. commune beta-glucosidase to an active site sequence proposed for a S. commune endoglucanase, suggesting the possibility of a common catalytic mechanism for these two glucolytic enzymes.

Amino Acid Sequence↗

Drosophila melanogaster tRNAVal3b genes and their allogenes.

Drosophila tRNAVal3b genes have been analyzed with respect to their nucleotide sequence and in vitro transcription efficiency. Plasmid pDt78R contains a single tRNA gene derived from the major tRNAVal3b gene cluster at chromosome band 84D. Its sequence corresponds to that of the tRNAVal3b. Two other plasmids, pDt41R and pDt48, each contain a tRNAVal3b-like gene from the minor tRNAVal3b gene cluster at chromosome bands 90BC. They contain the expected CAC anticodon, but their sequence differs from the tRNA at four positions. In homologous cell-free extracts, the tRNAVal3b variant genes in pDt41R and pDt48 are transcribed an order of magnitude more efficiently than the tRNAVal3b gene in pDt78R. However, the variant genes do not appear to contribute significantly to the in vivo tRNA pool [Larsen et al.: Mol. Gen. Genet. 185 (1982) 390-396]. We propose the term allogenes to describe families of related DNA sequences that may code for variant forms of a standard tRNA isoaccepting species.

Chromosome Mapping↗

Two thraustochytrid 5S ribosomal RNAs.

The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs.

Base Sequence↗

The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron.

The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are (formula: see text), respectively. Specific phylogenetic relationships of P. denitrificans with purple non-sulphur bacteria, and of Prochloron with cyanobacteria are demonstrated, and unique features of potential secondary structure are described.

Base Sequence↗

Comparative sequence analysis as an approach to evaluating structure, function, and evolution of 5S and 5.8S ribosomal RNAs.

Nucleotide sequences of nine eukaryotic and nine eubacterial 5S rRNAs have been selected for their diversity and subjected to analysis of primary and potential secondary structure. This analysis has allowed the quantitative confirmation of several previously made observations concerning 5S rRNA structure: (i) these two 5S rRNAs are derived from a common ancestor and probably perform essentially the same function in protein synthesis; (ii) one domain of 5S rRNA has undergone considerable divergence of structure (and presumably function) since the separation of the eukaryotic and eubacterial lineages; and (iii) single-stranded regions are more highly conserved than double-stranded regions. In addition, this analysis leads us to propose that (i) some of the highly conserved nucleotide residues in single-stranded regions interact in a specific manner with protein components of the translational apparatus, and (ii) repetitive folding and unfolding of helical regions occurs in two regions of eukaryotic 5S rRNA and one region of eubacterial 5S rRNA. In the context of these observations and propositions we also consider the potential secondary structure of plant mitochondrial 5S rRNA. Nucleotide sequences of 5.85 rRNAs have yielded less information about secondary structure and possible functional interactions. However, we have identified highly conserved and variable regions within this molecule and we show (in contrast to the situation with 5S rRNA) that these do not correlate well with proposed single-stranded and helical regions in a current model of 5.8S secondary structure.

Animals↗

Nucleotide sequences of Acanthamoeba castellanii 5S and 5.8S ribosomal ribonucleic acids: phylogenetic and comparative structural analyses.

Sequences of 5S and 5.8S rRNAs of the amoeboid protist Acanthamoeba castellanii have been determined by gel sequencing of terminally-labeled RNAs which were partially degraded with chemical reagents or ribonucleases. The sequence of the 5S rRNA is (formula, see text). This sequence is compared to eukaryotic 5S rRNA sequences previously published and fitted to a secondary structure model which incorporates features of several previously proposed models. All reported eukaryotic 5S rRNAs fit this model. The sequence of the 5.8S rRNA is (formula, see text). This sequence does not fit parts of existing secondary structure models for 5.8S rRNA, and we question the significance of such models.

Amoeba↗

Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

Animals↗