PubMed Health⌕ Search

Biomedical subjects

R Noyori

Publications and source records attributed to R Noyori.

At least 19 recordsLinked to original sources

Stereochemistry of aldols: configuration and conformation of aldols derived from cycloalkanones and aldehydes.

The structures of cycloalkanone-based threo and erythro aldols were investigated by systematic introduction of stereo-determining factors. The combination of single-crystal X-ray analysis and cryoscopic measurement and solution NMR and IR studies elucidated the detailed geometry of these typical aldols. Currently, X-ray diffraction is the only reliable spectroscopic method to determine the relative configuration of aldols. Empirical NMR analysis can be safely applied in only limited cases. In hydrocarbon solvents, many aldols exist as monomers with an intramolecular OH...O=C hydrogen bond, but some compounds are in an equilibrium with higher aggregates via intermolecular hydrogen bonds. The aldols take various staggered conformers, where the relative stabilities are controlled largely by torsional strain affected by the size and nature of substituents. The intramolecular and intermolecular hydrogen bonds, gauche interactions between the vicinal substituents, and sometimes CH/pi attractions significantly influence the distribution of conformers. The preferred structure in solution often differs greatly from the crystalline-state geometry.

Journal Article↗

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method.

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).

DNA↗

Self and nonself recognition of chiral catalysts: the origin of nonlinear effects in the amino-alcohol catalyzed asymmetric addition of diorganozincs to aldehydes.

Asymmetric addition of dialkylzincs to aldehydes in the presence of (2S)-3-exo-(dimethylamino)isoborneol [(S)-DAIB] exhibits various nonclassical phenomena. The enantiomeric excess (ee) of the alkylation product, obtained with partially resolved DAIB, is much higher than that of the chiral amino alcohol, while the rate decreases considerably as the ee of DAIB is lowered. The asymmetric amplification effects reflect the relative turnover numbers of two enantiomorphic catalytic cycles, where an essential feature is the reversible homochiral and heterochiral dimerization of the coexisting enantiomeric DAIB-based Zn catalysts. The interplay between the thermodynamics of the monomer/dimer equilibration and the kinetics of alkylation reaction strongly affect the overall profile of asymmetric catalysis. The self and nonself recognition of the chiral Zn catalysts is a general phenomenon when (S)-DAIB is mixed with its enantiomer, diastereomer, or even an achiral beta-amino alcohol. The degree of nonlinearity is highly affected not only by the structures and purity of catalysts but also by various reaction parameters. The salient features have been clarified on the basis of molecular weight measurements, NMR and X-ray crystallographic studies of organozinc complexes, and kinetic experiments, as well as computer-aided quantitative analysis.

Journal Article↗

Antitumor activity, optimum administration method and pharmacokinetics of 13,14-dihydro-15-deoxy-deoxy-Delta7 -prostaglandin A1 methyl ester (TEI-9826) integrated in lipid microspheres (Lipo TEI-9826).

13,14-Dihydro-15-deoxy-Delta7-prostaglandin A1 methyl ester (TEI-9826), an antitumor prostaglandin analog, is a candidate for clinical trial. In the present study, we examined its biological stability in vitro, antitumor activity in vitro and in vivo, and pharmacokinetics. Although TEI-9826 was rapidly hydrolyzed to the carboxylic acid form (TOK-4528), TOK-4528 as well as Delta12-prostaglandin J2 (PGJ2) were found to be stable in rat, mouse and human serum in vitro. TEI-9826 exhibited nearly identical or greater potential antitumor activity compared to Delta12-PGJ2 and Delta7-PGA1 in vitro against Colon26 tumor cells. Further evaluation of TEI-9826 using the 38 human cancer cell lines panel and COMPARE analysis suggested that its mode of action is quite different from other anticancer agents that are currently used. TEI-9826 was integrated into lipid microspheres (Lipo TEI-9826) for dosing. Growth inhibition by Lipo TEI-9826 against Colon26 tumor inoculated s.c. in mice depended on administration route, i.e. at 80 mg/kg, no growth suppressive effect was observed for daily bolus i.v., but significant growth suppressive effect was observed for daily i.p., daily s.c. every other day s.c. and 4 times a day continuous (5 min) i.v. These tumor growth-suppressive effects were cytostatic and the tumor started to regrow at the end or a few days after the end of administration. The pharmacokinetic study suggested that maintaining the blood level of TEI-9826 and/or TOK-4528 was essential for their antitumor effects. These results show that continuous i.v. infusion might be the most suitable administration method of Lipo TEI-9826 for clinical trial.

Animals↗

Asymmetric transfer hydrogenation of benzaldehydes

A combined system of RuCl[(R, R)-YCH(C(6)H(5))CH(C(6)H(5))NH(2)](eta(6)-arene) (Y = NSO(2)C(6)H(4)-4-CH(3) or O) and t-C(4)H(9)OK catalyzes the asymmetric transfer hydrogenation of various benzaldehyde-1-d derivatives with 2-propanol to yield (R)-benzyl-1-d alcohols in 95-99% ee and with >99% isotopic purity. Reaction of benzaldehydes with a DCO(2)D-triethylamine mixture and the R,R catalyst affords the S deuterated alcohols in 97-99% ee.

Journal Article↗

General asymmetric hydrogenation of hetero-aromatic ketones

trans-RuCl(2)[(R)-xylbinap][(R)-daipen] or the S,S complex acts as an efficient catalyst for asymmetric hydrogenation of hetero-aromatic ketones. The hydrogenation proceeds with a substrate-to-catalyst molar ratio of 1000-40000 to give chiral alcohols in high ee and high yield. The enantioselectivity appears to be little affected by the properties of the hetero-aromatic ring. This method allows for asymmetric synthesis of duloxetine, an inhibitor of serotonin and norepinephrine uptake carriers.

Journal Article↗

Selective hydrogenation of benzophenones to benzhydrols. Asymmetric synthesis of unsymmetrical diarylmethanols

[reaction: see text] trans-RuCl2[P(C6H4-4-CH3)3]2(NH2CH2CH2NH2) acts as a highly effective precatalyst for the hydrogenation of a variety of benzophenone derivatives to benzhydrols that proceeds smoothly at 8 atm and 23-35 degrees C in 2-propanol containing t-C4H9OK with a substrate/catalyst ratio of 2000-20000. Use of a BINAP/chiral diamine Ru complex effects asymmetric hydrogenation of various ortho-substituted benzophenones and benzoylferrocene to chiral diarylmethanols with consistently high ee.

Journal Article↗

CNS-specific prostacyclin ligands as neuronal survival-promoting factors in the brain.

Prostacyclin (PGI2) is a critical regulator of the cardiovascular system, via dilatation of vascular smooth muscle and inhibition of platelet aggregation (Moncada, S. 1982, Br. J. Pharmacol., 76, 3). Our previous studies demonstrated that a novel subtype of PGI2 receptor, which is clearly distinct from a peripheral subtype in terms of ligand specificity, is expressed in the rostral region of the brain, e.g. cerebral cortex, hippocampus, thalamus and striatum, and that (15R)-16-m-17,18,19,20-tetranorisocarbacyclin (15R-TIC) and 15-deoxy-16-m-17,18,19,20-tetranorisocarbacyclin (15-deoxy-TIC) specifically bind to the central nervous system (CNS)-specific PGI2 receptor. Here, we report that these CNS-specific PGI2 receptor ligands, including PGI2 itself, prevented the neuronal death. They prevented apoptotic cell death of hippocampal neurons induced by high (50%) oxygen atmosphere, xanthine + xanthine oxidase, and serum deprivation. IC50s for neuronal death were approximately 30 and 300 nM for 15-deoxy-TIC and 15R-TIC, respectively, which well correlated with the binding potency for the CNS-specific PGI2 receptor. 6-Keto-PGF1alpha (a stable metabolite of PGI2), peripheral nervous system-specific PGI2 ligands and other prostaglandins (PGs) than PGI2 did not show such neuroprotective effects. In vivo, 15R-TIC protected CA1 pyramidal neurons against ischaemic damage in gerbils. These results indicate that CNS-specific PGI2 ligands have neuronal survival-promoting activity both in vitro and in vivo, and may represent a new type of therapeutic drug for neurodegeneration.

Animals↗

A novel subtype of prostacyclin receptor in the central nervous system.

Recently, in the course of our search for the prostacyclin receptor in the brain, we found a novel subtype, designated as IP2, which was finely discriminated by use of the specific ligand (15R)-16-m-tolyl-17,18,19,20-tetranorisocarbacyclin (15R-TIC) and specifically localized in the rostral part of the brain. In the present study, the tritiated compound 15R-[15-(3)H]TIC was synthesized and utilized for more specific research on IP2. The specificity of binding to rat brain regions was confirmed by use of several prostacyclin derivatives including 15S-TIC. Mapping of 15R- and 15S-[3H]TIC binding in adjacent pairs of frozen sections of rat brain demonstrated a quite similar pattern of distribution in almost all rostral brain regions, indicating that the regions may contain only the IP2 subtype. On the other hand, 15R-[3H]TIC binding was very faint as compared with 15S-[3H]TIC binding in the caudal medullary region. High densities of 15R-[3H]TIC binding sites were shown in the dorsal part of the lateral septal nucleus, thalamic nuclei, limbic structures, and some of the cortical regions. Scatchard plot analysis showed two components of high-affinity 15R-[3H]TIC binding in the rostral regions, one with a K(D) value at approximately 1 nM and the other with approximately 30 nM. These results strengthen our previous finding that a different subtype of prostacyclin receptor is expressed in the CNS, and the map with 15R-[3H]TIC obtained here could guide further studies on the molecular and functional properties of the IP2.

Animals↗

Anti-cancer-prostaglandin-induced cell-cycle arrest and its modulation by an inhibitor of the ATP-dependent glutathione S-conjugate export pump (GS-X pump).

The A and J series of prostaglandins (PGs) accumulate in the nuclei to suppress the proliferation of cancer cells. Here we report that Delta7-PGA1 methyl ester, a synthetic anti-cancer PG, increased the level of mRNA for the cyclin-dependent kinase inhibitor p21 in human leukaemia HL-60 cells. The induction of p21 was associated with the accumulation of hypophosphorylated retinoblastoma protein (pRB) and the suppression of c-myc gene expression. Since the p53 gene is deleted in HL-60 cells, the anti-cancer PG is suggested to inhibit cancer cell growth by inducing p21 via a p53-independent pathway. Unlike HL-60 cells, cisplatin-resistant HL-60/R-CP cells were insensitive to Delta7-PGA1 methyl ester. While c-myc expression was transiently suppressed, neither G1 arrest nor hypophosphorylation of pRB was observed with the anti-cancer PG. Plasma membrane vesicles from HL-60/R-CP cells showed an enhanced level of GS-X pump (ATP-dependent glutathione S-conjugate export pump) activity towards the glutathione S-conjugate of Delta7-PGA1 methyl ester (Km 110 nM). GIF-0019 ¿N-carbomethoxy-S-[5-(4-benzoylphenyl)pentyl]glutathione dimethyl ester¿, a specific inhibitor of the GS-X pump, dose-dependently enhanced the cellular sensitivity of HL-60/R-CP cells to Delta7-PGA1 methyl ester and induced G1 arrest. The GS-X pump is suggested to play a pivotal role in modulating the biological action of the anti-cancer PG.

Adenosine Triphosphate↗

A "Green" route to adipic acid: direct oxidation of cyclohexenes with 30 percent hydrogen peroxide

Currently, the industrial production of adipic acid uses nitric acid oxidation of cyclohexanol or a cyclohexanol/cyclohexanone mixture. The nitrous oxide emission from this process measurably contributes to global warming and ozone depletion. Therefore, the development of an adipic acid production process that is less damaging to the environment is an important subject in chemical research. Cyclohexene can now be oxidized directly to colorless crystalline adipic acid with aqueous 30 percent hydrogen peroxide under organic solvent- and halide-free conditions, which could provide an ideal solution to this serious problem.

Journal Article↗

Rational design of antitumor prostaglandins with high biological stability.

microolecular design can overcome the metabolic instability of Delta7-PGA1, while maintaining its antitumor potency. Saturation of the C(13)-C(14) double bond enhances the biological stability but decreases the antiproliferative activity. Configurational inversion of the isomerase-sensitive C(12) stereocenter from the natural S to the unnatural R geometry not only enhances biological stability but also significantly suppresses the growth of the tumor cells. The 12R derivatives markedly increase the induction of p21, a Cdk inhibitor, leading to sharp cell cycle arrest at the G1 phase at a dose level so low that at this dose Delta7-PGA1 methyl ester scarcely exerts an effect. These conspicuous biological properties lead to long-term suppression of tumor cell growth. The structure-stability relationship demonstrates that the stability of prostaglandins (PGs) is crucially controlled by the C(12) configuration and is unaffected by the geometry of the hydroxy-bearing C(15). The successful design of antitumor PGs resistant to enzymatic metabolism provides a new strategy applicable to creating a useful PG for cancer chemotherapy.

Animals↗

Potent prostaglandin A1 analogs that suppress tumor cell growth through induction of p21 and reduction of cyclin E.

Although the cyclopentenone prostaglandin A1 (PGA1) is known to arrest the cell cycle at the G1 phase in vitro and to suppress tumor growth in vivo, its relatively weak activity limits its usefulness in cancer chemotherapy. In an attempt to develop antitumor drugs of greater potency and conspicuous biological specificity, we synthesized novel analogs based on the structure of PGA1. Of the newly synthesized analogs, 15-epi-delta7-PGA1 methyl ester (NAG-0092), 12-iso-delta7-PGA1 methyl ester (NAG-0093), and ent-delta7-PGA1 methyl ester (NAG-0022) possess a cross-conjugated dienone structure around the five-member ring with unnatural configurations at C(12) and/or C(15) and were found to be far more potent than native PGA1 in inhibiting cell growth and causing G1 arrest in A172 human glioma cells. These three analogs induced the expression of p21 at both RNA and protein levels in a time- and dose-dependent fashion. Kinase assays with A172 cells treated with these analogs revealed that both cyclin A- and E-dependent kinase activities were markedly reduced, although cyclin D1-dependent kinase activity was unaffected. Immunoprecipitation-Western blot analysis showed that the decrease in cyclin A-dependent kinase activity was due to an increased association of p21 with cyclin A-cyclin-dependent kinase 2 complexes, whereas the decrease in cyclin E-dependent activity was due to a combined mechanism involving reduction in cyclin E protein itself and increased association of p21. Thus, these newly synthesized PGA1 analogs may prove to be powerful tools in cancer chemotherapy as well as in investigations of the structural basis of the antiproliferative activity of A series prostaglandins.

Antineoplastic Agents↗

Synthesis of 11C/13C-labelled prostacyclins.

A one-pot synthesis of (15R)-16-(3-[11C]methylphenyl)-17,18,19, 20-tetranoriso-carbacyclin methyl ester was performed using a palladium-promoted reaction of [11C]methyl iodide with (15R)-16-(3-tri-n-butylstannylphenyl)-17,18,19, 20-tetranorisocarbacyclin methyl ester. The C-15 epimer (15S)-16-(3-[11C]methylphenyl)-17,18,19,20-tetranorisocarbacyclin methyl ester was synthesised in the same way starting from (15S)-16-(3-tributylstannylphenyl)-17,18,19,20-tetranorisocarba cyclin methyl ester. The decay-corrected radiochemical yields were 33-45% based on [11C]methyl iodide produced, and the radiochemical purity of the product was > 95%. The total synthesis time was 35 min, counted from end of radionuclide production to product ready for administration. The 11C-labelled prostacyclin methyl esters were easily hydrolysed using sodium hydroxide affording the 11C-labelled prostacyclin acids in quantitative yields. The stereoisomers (15R)-16-(3-methylphenyl)-17,18,19,20-tetranorisocarbacyclin [11C]methyl ester and (15S)-16-(3-methylphenyl)-17,18,19,20-tetranorisocarbacyclin [11C]methyl ester were synthesised by esterification using [11C]methyl iodide and the tetrabutylammonium salts of (15R)-16-(3-methylphenyl)-17,18,19,20-tetranorisocarbacyclin acid and (15S)-16-(3-methylphenyl)-17,18,19,20-tetranorisocarbacyclin acid, respectively. The decay-corrected radiochemical yields were in the range of 55% counting from [11C]methyl iodide produced, and the radiochemical purity of the product was > 95%. The total synthesis time was 35 min, counting from end of radionuclide production to product ready for administration. Both of these labelling methods can be used for labelling with 13C when (13C)methyl iodide is used. The methods described herein have already proved important since they enable the in vivo use of PET to study the action of prostacyclins in the brain.

Carbon Isotopes↗

[Pharmaceutical and pharmacological development of antitumor prostaglandins].

Antitumor Prostaglandins such as delta 12PGJ2 and delta 7PGA1 possess a cross-conjugated dienone unit and exhibit unique antitumor effect. Lipid microshere (w/o type emulsion) was selected as pharmaceutical formulation because of physicochemical properties of prostaglandin. 13,14-Dihydro-15-deoxy-delta 7-PGA1 methyl ester (TEI-9826) were selected as a candidate for clinical trial. In a rat and mouse serum in vitro, TEI-9826 rapidly metabolized to 13,14-dihydro-15-deoxy-delta 7-PGA1 (TOK-4528), but TOK-4528 is stable as well as delta 12PGJ2. Lipid microshere containing TEI-9826 at the content of 5 mg/ml exhibited administration route and schedule dependent antitumor effect in vivo using Colon 26 bearing mouse model, which suggested that duration of serum concentration was important for antitumor effect. One of the antitumor mechanism of antitumor PG might be an induction of the cyclin-dependent kinase inhibitor p21. PPAR gamma also might be important. New type homogenizer, high pressure jet flow type homogenizer was developed in the study of antitumor prostaglandin.

Animals↗