Biomedical subjects

R Printz

Publications and source records attributed to R Printz.

8 recordsLinked to original sources

PubMed2001

Exercise increases hexokinase II mRNA, but not activity in obesity and type 2 diabetes.

Glucose phosphorylation, catalyzed by hexokinase, is the first committed step in glucose uptake in skeletal muscle. Hexokinase II (HKII) is the isoform that is present in muscle and is regulated by insulin and muscle contraction. Glucose phosphorylation and HKII expression are both reduced in obese and type 2 diabetic subjects. A single bout of exercise increases HKII mRNA and activity in muscle from healthy subjects. The present study was performed to determine if a moderate exercise increases HKII mRNA expression and activity in patients with type 2 diabetes. Muscle biopsies were performed before and 3 hours after a single bout of cycle ergometer exercise in obese and type 2 diabetic patients. HKII mRNA and activity and glycogen synthase activity were determined in the muscle biopsies. Exercise increased HKII mRNA in obese and diabetic subjects by 1.67 +/- 0.34 and 1.87 +/- 0.26-fold, respectively (P <.05 for both). Exercise did not significantly increase HKI mRNA. When HKII mRNA increases were compared with the 2.26 +/- 0.36-fold increase in HKII mRNA previously reported for healthy lean subjects, no statistically significant differences were found. In contrast to the increase in HKII activity observed after exercise by lean healthy controls, exercise did not increase HKII activity in obese nondiabetic or diabetic subjects. Exercise increased glycogen synthase activity (GS(0.1) and GS(FV)) significantly in both obese nondiabetic and type 2 diabetic patients. The present results indicate that there is a posttranscriptional defect in the response of HKII expression to exercise in obese and type 2 diabetic subjects. This defect may contribute to reduced HKII activity and glucose uptake in these patients.

Adult↗

PubMed2000

Regulation of hexokinase II expression in human skeletal muscle in vivo.

The phosphorylation of glucose to glucose-6-phosphate (G-6-P) is the first committed step in glucose uptake in skeletal muscle. This reaction is catalyzed by hexokinase (HK). Two HK isoforms, HKI and HKII, are expressed in human skeletal muscle, but only HKII is regulated by insulin. The present study was undertaken to determine the time course for the regulation of HK activity and expression by physiological plasma insulin concentrations in human skeletal muscle in vivo. A hyperinsulinemic-euglycemic glucose clamp and percutaneous muscle biopsy were performed in separate groups of healthy subjects after 60, 120, 180, and 360 minutes of euglycemic hyperinsulinemia. Muscle biopsies were subfractionated into soluble and particulate fractions to determine HKI and HKII activities. RNA was extracted from a separate portion of the muscle biopsy, and HKI and HKII mRNA content was determined using an RNase protection assay. Glycogen synthase (GS) activity and fractional velocity were also determined. HKII mRNA was increased 2-fold by 120 minutes and remained high versus the basal value for up to 360 minutes. HKI mRNA was unchanged throughout the study. HKII activity increased after 360 minutes of insulin infusion, and this increase was limited to the soluble fraction. In contrast, insulin induced a 1.5- to 2-fold increase in GS fractional velocity that was sustained for 360 minutes. The time course of the ability of hyperinsulinemia to increase HKII mRNA indicates that insulin is likely a physiological regulator of HKII expression in human skeletal muscle in vivo.

Adult↗

PubMed1998

Regulation of hexokinase II activity and expression in human muscle by moderate exercise.

A single bout of exercise increases the rate of insulin-stimulated glucose uptake and metabolism in skeletal muscle. Exercise also increases insulin-stimulated glucose 6-phosphate in skeletal muscle, suggesting that exercise increases hexokinase activity. Within 3 h, exercise increases hexokinase II (HK II) mRNA and activity in skeletal muscle from rats. It is not known, however, if a single bout of moderate-intensity exercise increases HK II expression in humans. The present study was undertaken to answer this question. Six subjects had percutaneous biopsies of the vastus lateralis muscle before and 3 h after a single 3-h session of moderate-intensity aerobic (60% of maximal oxygen consumption) exercise. Glycogen synthase, HK I, and HK II activities as well as HK I and HK II mRNA content were determined from the muscle biopsy specimens. The fractional velocity of glycogen synthase was increased by 446 +/- 84% after exercise (P < 0.005). Hexokinase II activity in the soluble fraction of the homogenates increased from 1.2 +/- 0.4 to 4.5 +/- 1.6 pmol.min-1.microgram-1 (P < 0.05) but was unchanged in the particulate fraction (4.3 +/- 1.3 vs. 5.3 +/- 1.5). HK I activity in neither the soluble nor particulate fraction changed after exercise. Relative to a 28S rRNA control signal, HK II mRNA increased from 0.091 +/- 0.02 to 0.195 +/- 0.037 (P < 0.05), whereas HK I mRNA was unchanged (0.414 +/- 0.061 vs. 0.498 +/- 0.134, P < 0.20). The increase in HK II activity after moderate exercise in healthy subjects could be one factor responsible for the enhanced rate of insulin-stimulated glucose uptake seen after exercise.

Adult↗

PubMed1998

Effects of insulin on subcellular localization of hexokinase II in human skeletal muscle in vivo.

The phosphorylation of glucose to glucose-6-phosphate, catalyzed by hexokinase, is the first committed step in glucose uptake into skeletal muscle. Two isoforms of hexokinase, HKI and HKII, are expressed in human skeletal muscle, but only HKII expression is regulated by insulin. HKII messenger RNA, protein, and activity are increased after 4 h of insulin infusion; however, glucose uptake is stimulated much more rapidly, occurring within minutes. Studies in rat muscle suggest that changes in the subcellular distribution of HKII may be an important regulatory factor for glucose uptake. The present studies were undertaken to determine if insulin causes an acute redistribution of HKII activity in human skeletal muscle in vivo. Muscle biopsies (vastus lateralis muscle) were performed before and at the end of 30 min insulin infusion, performed using the euglycemic clamp technique. Muscle biopsies were subfractionated into soluble and particulate fractions to determine if insulin acutely changes the subcellular distribution of HKII. Insulin decreased HKII activity in the soluble fraction from 2.20 +/- 0.31 to 1.40 +/- 0.18 pmoles/(min[chempt]micrograms) and increased HKII activity in the particulate fraction from 3.02 +/- 0.46 to 3.45 +/- 0.46 pmoles/(min[chempt]micrograms) (P < 0.01 for both). These changes in HKII activity were correlated with changes in HKII protein, as determined by immunoblot analysis (r = 0.53, P = 0.05). Insulin had no effect on the subcellular distribution of HKII activity, which was primarily restricted to the soluble fraction. These studies are consistent with the conclusion that, in vivo in human skeletal muscle, insulin changes the subcellular distribution of HKII within 30 min.

Adult↗

PubMed1998

Insulin-induced hexokinase II expression is reduced in obesity and NIDDM.

NIDDM and obesity are characterized by decreased insulin-stimulated glucose uptake in muscle. It has been suggested that impaired glucose phosphorylation to glucose-6-phosphate, catalyzed in muscle by hexokinase (HK)II, may contribute to this insulin resistance. Insulin is known to increase HKII mRNA, protein, and activity in lean nondiabetic individuals. The purpose of this study was to determine whether defects in insulin-stimulated HKII expression and activity could contribute to the insulin resistance of obesity and NIDDM. Fifteen lean nondiabetic control subjects, 17 obese nondiabetic subjects, and 14 obese NIDDM patients were studied. Percutaneous muscle biopsies of the vastus lateralis were performed in conjunction with leg balance and local indirect calorimetry measurements before and at the end of a 3-h euglycemic-hyperinsulinemic clamp (40 or 240 mU x min(-1) x m[-2]). Leg glucose uptake in response to the 40-mU insulin infusion was higher in the lean control subjects (2.53 +/- 0.35 micromol x min(-1) per x 100 ml leg vol) than in obese (1.46 +/- 0.50) or NIDDM (0.53 +/- 0.25, P < 0.05) patients. In response to 240 mU insulin, leg glucose uptake was similar in all of the groups. In response to 40 mU insulin, HKII mRNA in lean control subjects was increased 1.48 +/- 0.18-fold (P < 0.05) but failed to increase significantly in the obese (1.12 +/- 0.24) or NIDDM (1.14 +/- 0.18) groups. In response to 240 mU insulin, HKII mRNA was increased in all groups (control subjects 1.48 +/- 0.18, P < 0.05 vs. basal, obese 1.30 +/- 0.16, P < 0.05, and NIDDM 1.25 +/- 0.14, P < 0.05). Under basal conditions, HKI and HKII activities did not differ significantly between groups. Neither the 40 mU nor the 240 mU insulin infusion affected HK activity. Total HKII activity was reduced in the obese subjects (4.33 +/- 0.08 pmol x min(-1) x g(-1) muscle protein) relative to the lean control subjects (5.00 +/- 0.08, P < 0.05). There was a further reduction in the diabetic patients (3.10 +/- 0.10, P < 0.01 vs. the control subjects, P < 0.01 vs. the obese subjects). Resistance to insulin's metabolic effects extends to its ability to induce HKII expression in obesity and NIDDM.

Adult↗

PubMed1985

Regulatory subunit of cAMP-dependent protein kinase inhibits phosphoprotein phosphatase.

The activity of a purified high molecular weight phosphoprotein phosphatase was inhibited by purified type II cAMP-dependent protein kinase. This effect required cAMP and was obtained in the absence of ATP. The isolated type II regulatory subunits (R-subunits) from several species also inhibited the phosphatase activity in both crude extracts and purified preparations. Half maximal inhibition was observed at 0.06-0.25 microM, well within the physiological range of R-subunit concentrations. The inhibitory potency of R-subunit was greater using the thiophosphorylated form. Limited trypsinization of the R-subunit abolished the inhibitory activity. The C-subunit released the bound cAMP when combined with R-subunit, but the phosphatase did not, implying that the inhibited species is a R.cAMP-phosphatase complex. The results suggest that the R-subunit might have at least one physiological role in addition to inhibition of the C-subunit, i.e., inhibition of phosphatase. The latter would occur only when cAMP is elevated.

Adenosine Triphosphate↗

PubMed1985

Variability within the rabbit C repeats and sequences shared with other SINES.

The C family of short, interspersed repeats (SINES) is highly repeated in the rabbit genome, and most members have a structure suggestive of a model for their dispersal via reinsertion of a double-stranded copy of an RNA polymerase III transcribed RNA. We have determined the nucleotide sequence of additional members of the repeat family and have compiled them to obtain an improved consensus sequence. This compilation shows that although most regions of the repeat are well conserved, two regions show high variability. Some individual repeats are truncated, and one truncated repeat retains the characteristic structures of a retroposon. The consensus sequence for C repeats does not match the sequence of any other sequenced mammalian SINE over large regions, but short imperfect matches to several primate and rodent SINES are observed. A sequence similar to the 27 nucleotide consensus sequence TCCCAGCAACCACATGGGAGGCAGAGA was found in all mammalian SINES examined. The 3' portion of this sequence matches a DNA segment found at the replication origins of papovaviruses.

Animals↗

PubMed1984

The rabbit C family of short, interspersed repeats. Nucleotide sequence determination and transcriptional analysis.

The C repeat family was first observed in the rabbit beta-like gene family. We have estimated the repetition frequency of the C repeats, determined the nucleotide sequence of three intact members and one truncated member, and have investigated the size, tissue specificity, and intracellular localization of C repeat transcripts. Members of the C repeat family are short (average size of 316 base-pairs) and are repeated about 170,000 times per haploid genome in a widely dispersed pattern. They end in a 3' poly(dA) tract and are flanked by direct repeats that range in size from 8 to 16 base-pairs. The consensus internal control regions for polymerase III transcription are located near the 5' end. Different amounts of C repeat RNA accumulate in a variety of tissues, and most of the transcripts are confined to the nucleus. A heterogeneous distribution of C repeat RNA sizes was found, ranging from about 330 to 8200 nucleotides. These structural and transcriptional properties are similar to those of primate and rodent Alu and Alu-like repeats. However, the C repeats are not similar in sequence to the Alu repeats. Thus two different types of short, interspersed repeats capable of being transcribed and proposed to be transposable elements have now been identified in mammals. The positions of these short repeats in mammalian beta-like globin gene families are not tightly conserved.

Animals↗