PubMed Health⌕ Search

Biomedical subjects

R Shen

Publications and source records attributed to R Shen.

At least 19 recordsLinked to original sources
PubMed2006

Neuropeptide-stimulated cell migration in prostate cancer cells is mediated by RhoA kinase signaling and inhibited by neutral endopeptidase.

The neuropeptides bombesin and endothelin-1 stimulate prostate cancer (PC) cell migration and invasion (J Clin Invest, 2000; 106: 1399-1407). The intracellular signaling pathways that direct this cell movement are not well delineated. The monomeric GTPase RhoA is required for migration in several cell types including neutrophils, monocytes and fibroblasts. We demonstrate that bombesin-stimulated PC cell migration occurs via the heterotrimeric G-protein-coupled receptors (G-protein) G alpha 13 subunit leading to activation of RhoA, and Rho-associated coiled-coil forming protein kinase (ROCK). Using siRNA to suppress expression of the three known G-protein alpha-subunit-associated RhoA guanine nucleotide exchange factors (GEFs), we also show that two of these RhoA GEFs, PDZ-RhoGEF and leukemia-associated RhoGEF (LARG), link bombesin receptors to RhoA in a non-redundant manner in PC cells. We next show that focal adhesion kinase, which activates PDZ-RhoGEF and LARG, is required for bombesin-stimulated RhoA activation. Neutral endopeptidase (NEP) is expressed on normal prostate epithelium whereas loss of NEP expression contributes to PC progression. We also demonstrate that NEP inhibits neuropeptide activation of RhoA. Together, these results establish a contiguous signaling pathway from the bombesin receptor to ROCK in PC cells, and they implicate NEP as a major regulator of neuropeptide-stimulated RhoA in these cells. This work also identifies members of this signaling pathway as potential targets for rational pharmacologic manipulation of neuropeptide-stimulated migration of PC cells.

Bombesin↗
PubMed2006

Activation of p300 histone acetyltransferase activity and acetylation of the androgen receptor by bombesin in prostate cancer cells.

Androgen receptor signaling in prostate cancer cells is augmented by the androgen receptor (AR) coactivator p300, which transactivates and acetylates the AR in the presence of dihydrotestosterone (DHT). As prostate cancer (PC) cells progress to androgen independence, AR signaling remains intact, indicating that other factors stimulate AR activities in the absence of androgen. We previously reported that neuropeptide growth factors could transactivate the AR in the presence of very low concentrations of DHT. Here, we examine the involvement of p300 in neuropeptide activation of AR signaling. Transfection of increasing concentrations of p300 in the presence of bombesin into PC-3 cells resulted in a linear increase in AR transactivation, suggesting that p300 acts as a coactivator in neuropeptide-mediated AR transactivation. P300 is endowed with histone acetyltransferase (HAT) activity. Therefore, we examine the effect of bombesin on p300 HAT activity. At 4 h after the addition of bombesin, p300 HAT activity increased 2.0-fold (P<0.01). Incubation with neutral endopeptidase, which degrades bombesin, or bombesin receptor antagonists blocked bombesin-induced p300 HAT activity. To explore the potential signaling pathways involved in bombesin-induced p300 HAT activity, we examined Src and PKCdelta pathways that mediate bombesin signaling. Inhibitors of Src kinase activity or Src kinase siRNA blocked bombesin-induced p300 HAT activity, whereas PKCdelta inhibitors or PKCdelta siRNA significantly increased bombesin-induced p300 HAT activity suggesting that Src kinase and PKCdelta kinase are involved in the regulation of p300 HAT activity. As AR is acetylated in the presence of 100 nM DHT, we next examined whether bombesin-induced p300 HAT activity would result in enhanced AR acetylation. Bombesin-induced AR acetylation at the same motif KLKK observed in DHT-induced acetylation. Elimination of p300 using p300 siRNA reduced AR acetylation, demonstrating that AR acetylation was mediated by p300. AR acetylation results in AR transactivation and the expression of the AR-regulated gene prostate-specific antigen (PSA). Therefore, we examined bombesin-induced AR transactivation and PSA expression in the presence and absence of p300 siRNA and found inhibition of p300 expression reduced bombesin-induced AR transactivation and PSA expression. Together these results demonstrate that bombesin, via Src and PKCdelta signaling pathways, activates p300 HAT activity which leads to enhanced acetylation of AR resulting in increased expression of AR-regulated genes.

Acetylation↗
PubMed2004

Effects of testosterone replacement in human immunodeficiency virus-infected women with weight loss.

The objective of this study was to determine whether physiological testosterone replacement increases fat-free mass (FFM) and muscle strength and contributes to weight maintenance in HIV-infected women with relative androgen deficiency and weight loss. Fifty-two HIV-infected, medically stable women, 18-50 yr of age, with more than 5% weight loss over 6 months and testosterone levels below 33 ng/dl were randomized into this double-blind, placebo-controlled trial of 24-wk duration. Subjects in the testosterone group applied testosterone patches twice weekly to achieve a nominal delivery of 300 mug testosterone over 24 h. Data were evaluable for 44 women. Serum average total and peak testosterone levels increased significantly in the testosterone group, but did not change in the placebo group. However, there were no significant changes in FFM (testosterone, 0.7 +/- 0.4 kg; placebo, 0.3 +/- 0.4 kg), fat mass (testosterone, 0.3 +/- 0.7 kg; placebo, 0.6 +/- 0.7 kg), or body weight (testosterone, 1.0 +/- 0.9 kg; placebo, 0.9 +/- 0.8 kg) between the two treatment groups. There were no significant changes in leg press strength, leg power, or muscle fatigability in either group. Changes in quality of life, sexual function, cognitive function, and Karnofsky performance scores did not differ significantly between the two groups. High-density lipoprotein cholesterol levels decreased significantly in the testosterone group. The patches were well tolerated. We conclude that physiological testosterone replacement was safe and effective in raising testosterone levels into the mid to high normal range, but did not significantly increase FFM, body weight, or muscle performance in HIV-infected women with low testosterone levels and mild weight loss. Additional studies are needed to fully explore the role of androgens in the regulation of body composition in women.

Adolescent↗
PubMed2004

Prenatal ethanol exposure alters the postnatal development of the spontaneous electrical activity of dopamine neurons in the ventral tegmental area.

Prenatal ethanol exposure causes a persistent reduction in the spontaneous electrical activity of dopamine (DA) neurons in the ventral tegmental area (VTA) in adult animals. Because DA neuron activity matures into adult pattern during postnatal development, it is possible that reduced activity in VTA DA neurons after prenatal ethanol exposure is caused by impaired postnatal development. This possibility was investigated in the present study using the in vivo extracellular single-unit recording and brain stimulation techniques. The results show an age-dependent decrease in the number of spontaneously active VTA DA neurons from 2 to 4 weeks of age in both the control and prenatal ethanol-exposed animals. In ethanol-exposed animals, the age-dependent decrease was more prominent after 3 weeks of age, resulting in lower numbers of spontaneously active VTA DA neurons in 4-week-old and adult animals. In both the control and ethanol-exposed animals, there were age-dependent increases in the firing rates and burst firing activity of VTA DA neurons after 2 weeks of age. Ethanol exposure led to slightly lower firing rates in 4-week-old and adult animals and did not impact the burst firing pattern in any age groups. There were no changes in axon conduction velocity and antidromic spike characteristics of VTA DA neurons. These results indicate that reduced activity of VTA DA neurons during adulthood after prenatal ethanol exposure does not begin prenatally. Instead, it is a result of impaired postnatal development manifested only when animals reach 4 weeks of age. These results suggest that early intervention may be an effective treatment strategy for attention deficit/hyperactivity disorder, a behavioral dysfunction related to the abnormalities of DA systems and often observed in children with fetal alcohol spectrum disorder.

Action Potentials↗
PubMed2001

Suppression of matrix metalloproteinase-2 gene expression and invasion in human glioma cells by MMAC/PTEN.

Human gliomas are highly invasive, and remain to be a major obstacle for any effective therapeutic remedy. Among many other factors, gliomas express elevated levels of matrix metalloproteinases (MMPs), which have been implicated to play an important role in tumor invasion as well as neovascularization. The tumor suppressor gene mutated in multiple advanced cancers/phosphatase and tensin homologue (MMAC/PTEN) has been shown to inhibit cell migration, spreading, and focal adhesion. In this study, we determined whether MMAC/PTEN inhibits tumor invasion by modulating MMP-2 activity. Our results showed that reintroduction of the MMAC/PTEN gene into human glioma U251 and U87 cells modified their phenotype and growth characteristics. The ability of MMAC/PTEN to induce anoikis in U251 cells was accompanied by a significant inhibition of in vitro invasion (70%). Expression of MMAC/PTEN in U251 and U87 cells inhibited MMP-2 enzymatic activity as determined by zymography. Furthermore, MMAC/PTEN expression strongly decreased MMP-2 mRNA levels, which correlated well with the inhibition of invasion capacity in these cells. Concomitant with MMP-2 expression and activity, MMP-2 promoter activity was also reduced in MMAC/PTEN expressing cells. Our observations suggest that MMAC/PTEN inhibits tumor cell invasion in part by regulating MMP-2 gene transcription and thereby its enzymatic activity. Further characterization of this regulation will facilitate the development of MMAC/PTEN based gene therapy for gliomas.

Anoikis↗
PubMed2001

6-Substituted-4-(3-bromophenylamino)quinazolines as putative irreversible inhibitors of the epidermal growth factor receptor (EGFR) and human epidermal growth factor receptor (HER-2) tyrosine kinases with enhanced antitumor activity.

A series of new 6-substituted-4-(3-bromophenylamino)quinazoline derivatives that may function as irreversible inhibitors of epidermal growth factor receptor (EGFR) and human epidermal growth factor receptor (HER-2) tyrosine kinases have been prepared. These inhibitors have, at the C-6 position, butynamide, crotonamide, and methacrylamide Michael acceptors bearing water-solublilizing substituents. These compounds were prepared by acylation of 6-amino-4-(3-bromophenylamino)quinazoline with unsaturated acid chlorides or mixed anhydrides. We show that attaching a basic functional group onto the Michael acceptor results in greater reactivity, due to intramolecular catalysis of the Michael addition and/or an inductive effect of the protonated basic group. This, along with improved water solubility, results in compounds with enhanced biological properties. We present molecular modeling and experimental evidence that these inhibitors interact covalently with the target enzymes. One compound, 16a, was shown to have excellent oral activity in a human epidermoid carcinoma (A431) xenograft model in nude mice.

Administration, Oral↗
PubMed2001

Neutral endopeptidase inhibits neuropeptide-mediated transactivation of the insulin-like growth factor receptor-Akt cell survival pathway.

G-protein coupled receptor (GPCR) agonists such as neuropeptides activate the insulin-like growth factor-1 receptor (IGF-IR) or the serine-threonine protein kinase Akt, suggesting that neuropeptides-GPCR signaling can cross-communicate with IGF-IR-Akt signaling pathways. Neutral endopeptidase 24.11 (NEP) is a cell-surface peptidase that cleaves and inactivates the neuropeptides endothelin-1 (ET-1) and bombesin, which are implicated in progression to androgen-independent prostate cancer (PC). We investigated the mechanisms of NEP regulation of neuropeptide-mediated cell survival in PC cells, including whether neuropeptide substrates of NEP induce phosphorylations of IGF-IR and Akt in PC cells. Western analyses revealed ET-1 and bombesin treatment induced phosphorylation of IGF-IRbeta and Akt independent of IGF-I in TSU-Pr1, DU145, and PC-3 PC cells, which lack NEP expression, but not in NEP-expressing LNCaP cells. Recombinant NEP and induced NEP expression in TSU-Pr1 cells using a tetracycline-repressive expression system inhibited ET-1-mediated phosphorylation of IGF-IRbeta and Akt, and blocked the protective effects of ET-1 against apoptosis induced by serum starvation. Incubation of TSU-Pr1 cells with specific kinase inhibitors together with ET-1 or bombesin showed that IGF-IR activation is required for neuropeptide-induced Akt phosphorylation, and that neuropeptide-induced Akt activation is predominantly mediated by Src and phosphatidylinositol 3-kinase but not by mitogen-activated protein kinase or protein kinase C. These data show that the neuropeptides ET-1 and bombesin stimulate ligand-independent activation of the IGF-IR, which results in Akt activation, and that this cross-communication between GPCR and IGF-IR signaling is inhibited by NEP.

Bombesin↗
PubMed2001

A comparison of whole wheat, refined wheat and wheat bran as inhibitors of heterocyclic amines in the Salmonella mutagenicity assay and in the rat colonic aberrant crypt focus assay.

Refined wheat, unrefined whole wheat, and wheat bran were studied for their ability to protect against heterocyclic amines (HCAs) in vitro and in vivo. Wheat bran, which binds HCAs in vitro, as well as refined wheat and unrefined whole wheat, inhibited the mutagenic activities of 2-amino-3-methylimidazo[4,5-f]quinoline (IQ), 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) and 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx) when they were co-incubated and the supernatant (minus grain) was added to the Salmonella assay. The water-soluble fraction alone from refined and unrefined wheat, but not bran, also inhibited against these mutagens in vitro. In vivo, AIN-93G diets containing refined wheat or unrefined wheat were examined for their ability to inhibit IQ-induced colonic aberrant crypt foci (ACF) in the Fischer 344 rat. A slight increase in the number of AC/ACF (aberrant crypts/ACF) was seen after 16 weeks in rats treated post-initiation with refined wheat (P < 0.05), and fewer foci with two or three aberrant crypts (ACF-2) were found in rats given unrefined whole wheat post-initiation compared with animals treated with the same diet during the initiation phase (P < 0.05). There was no significant difference in the profile of IQ urinary metabolites or excretion of promutagens 0-48 h after carcinogen dosing, and grains had no effect on hepatic cytochrome P4501A1 (CYP1A1), CYP1A2, aryl sulfotransferase or N-acetyltransferase activities; however, a slightly higher UDP-glucuronosyl transferase activity was observed in rats fed unrefined wheat compared with refined wheat diets (P < 0.05). Thus, despite their antimutagenic activities in vitro, only marginal effects were seen with refined and unrefined wheat in vivo with respect to hepatic enzyme activities, carcinogen metabolism and IQ-induced ACF in the rat colon.

Amines↗
PubMed2001

Testosterone dose-response relationships in healthy young men.

Testosterone increases muscle mass and strength and regulates other physiological processes, but we do not know whether testosterone effects are dose dependent and whether dose requirements for maintaining various androgen-dependent processes are similar. To determine the effects of graded doses of testosterone on body composition, muscle size, strength, power, sexual and cognitive functions, prostate-specific antigen (PSA), plasma lipids, hemoglobin, and insulin-like growth factor I (IGF-I) levels, 61 eugonadal men, 18-35 yr, were randomized to one of five groups to receive monthly injections of a long-acting gonadotropin-releasing hormone (GnRH) agonist, to suppress endogenous testosterone secretion, and weekly injections of 25, 50, 125, 300, or 600 mg of testosterone enanthate for 20 wk. Energy and protein intakes were standardized. The administration of the GnRH agonist plus graded doses of testosterone resulted in mean nadir testosterone concentrations of 253, 306, 542, 1,345, and 2,370 ng/dl at the 25-, 50-, 125-, 300-, and 600-mg doses, respectively. Fat-free mass increased dose dependently in men receiving 125, 300, or 600 mg of testosterone weekly (change +3.4, 5.2, and 7.9 kg, respectively). The changes in fat-free mass were highly dependent on testosterone dose (P = 0.0001) and correlated with log testosterone concentrations (r = 0.73, P = 0.0001). Changes in leg press strength, leg power, thigh and quadriceps muscle volumes, hemoglobin, and IGF-I were positively correlated with testosterone concentrations, whereas changes in fat mass and plasma high-density lipoprotein (HDL) cholesterol were negatively correlated. Sexual function, visual-spatial cognition and mood, and PSA levels did not change significantly at any dose. We conclude that changes in circulating testosterone concentrations, induced by GnRH agonist and testosterone administration, are associated with testosterone dose- and concentration-dependent changes in fat-free mass, muscle size, strength and power, fat mass, hemoglobin, HDL cholesterol, and IGF-I levels, in conformity with a single linear dose-response relationship. However, different androgen-dependent processes have different testosterone dose-response relationships.

Adult↗
PubMed2001

Pharmacokinetics of a transdermal testosterone system in men with end stage renal disease receiving maintenance hemodialysis and healthy hypogonadal men.

Androgen deficiency is common in men with end stage renal disease (ESRD) on maintenance hemodialysis. Pharmacokinetics of transdermal testosterone in men receiving maintenance hemodialysis have not been studied. Our objective was to compare the pharmacokinetics of a transdermal testosterone system in healthy hypogonadal men and in men with ESRD on maintenance hemodialysis. We recruited 10 healthy hypogonadal men and 8 medically stable men on maintenance hemodialysis, 18--70 yr old, who had serum testosterone less than 300 ng/dL. After baseline sampling during a 24-h control period, two testosterone patches were applied daily for 28 days, to achieve a nominal delivery of 10-mg testosterone daily. In addition to single, pooled samples on days 7, 14, and 21, blood was drawn at 0, 2, 4, 6, 8, and 24 h on day 28 in healthy hypogonadal men and on an interdialytic day (day 21 or 28) as well as a dialysis day (day 21 or 28) in men on hemodialysis. On the dialysis day (day 21 or 28), serum free and total testosterone levels were measured hourly for 4 h before hemodialysis and for 4 h during hemodialysis. The dialysate was sampled for testosterone measurement. Baseline mean + SD total (92 +/- 82 vs. 222 +/- 50 ng/dL) and free (11 +/- 9 vs. 27 +/- 6 pg/mL) testosterone concentrations were lower in healthy hypogonadal men than in men with ESRD. After application of two testosterone patches, serum total and free testosterone concentrations rose into the midnormal range in both groups of men. Time-average, steady state (total testosterone, 506 +/- 88 vs. 516 +/- 86 ng/dL; free testosterone, 55 +/- 9 vs. 67 +/- 11 pg/mL), minimum, and maximum total and free testosterone concentrations were not significantly different between the two groups of men during treatment. Increments in total and free testosterone concentrations above baseline, baseline-subtracted areas under the total and free testosterone curves, and half-life of testosterone elimination (t(1/2), 2.1 +/- 0.1 vs. 2.1 +/- 0.2 h, P = not significant) were not significantly different between the two groups. In men receiving hemodialysis, time-average, steady state, and maximal total and free testosterone concentrations and baseline-subtracted areas under the total and free testosterone curves were higher on dialysis day than on an interdialytic day. On the day of hemodialysis, time-average total and free testosterone concentrations were not significantly different during the 4 h before or during hemodialysis. The amount of testosterone removed in the dialysate (8.4 +/- 1.6 microg during 4 h of hemodialysis) was small compared with the daily testosterone production rates in healthy young men. Serum dihydrotestosterone and estradiol concentrations increased into the normal male range and were not significantly different between the two groups. Percent suppression of LH was greater in men with ESRD than in healthy hypogonadal men. A regimen of two Testoderm TTS testosterone patches (Alza Corp., Mountain View, CA) daily can maintain serum concentrations of total and free testosterone and its metabolites dihydrotestosterone and estradiol in the midnormal range in healthy hypogonadal men and men on hemodialysis. The amount of testosterone cleared by hemodialysis is small, and hemodialysis does not significantly affect serum total and free testosterone concentrations in men treated with the testosterone patch.

Administration, Cutaneous↗
PubMed2001

Tumor-suppressive effects of neutral endopeptidase in androgen-independent prostate cancer cells.

Expression of neutral endopeptidase (NEP) 24.11 is diminished in metastatic, androgen-independent prostate cancers (PCs; C. N. Papandreou et al., NAT: MED:, 4: 50--57, 1998). To determine the effects on androgen-independent PC cells of overexpressing cell-surface NEP, an inducible tetracycline-regulatory gene expression system was used to stably introduce and express the NEP gene in androgen-independent TSU-Pr1 cells generating WT-5 cells, which expressed high levels of enzymatically active NEP protein when cultured in the absence of tetracycline. TN12 cells, which contain the identical vectors without the NEP gene and do not express NEP, were used as control. Expression of NEP in WT-5 cells after removal of tetracycline from the media resulted in a >80% inhibition in cell proliferation over a 1-week period (P < 0.005) compared with control cells. Tumor formation occurred in the prostate glands of orthotopically injected athymic mice killed at 30 days in 4 of 5 mice that were given injections of 2 x 10(6) WT-5 cells and were fed doxycycline (NEP suppressed), and in all mice that were given injections of TN12 cells and were fed with or without doxycycline. In contrast, only 1 of 5 mouse prostates developed a tumor in mice that were given injections of WT-5 cells and that did not receive doxycycline. Analysis of the mechanisms of NEP-induced growth suppression revealed that NEP expression in WT-5 cells induced a 4-fold increase in the number of PC cells undergoing apoptosis, and increased the expression of p21 tumor suppressor gene protein and the level of unphosphorylated retinoblastoma protein as determined by Western blot. Flow cytometric analysis show that induced NEP expression in WT-5 cells resulted in a G(1) cell cycle arrest. These data show that NEP can inhibit PC cell growth and tumorigenicity and suggest that NEP has potential as therapy for androgen-independent PC.

Androgens↗
PubMed2001

Distribution and mobility of aluminium in an Al-accumulating plant, Fagopyrum esculentum Moench.

Buckwheat (Fagopyrum esculentum Moench. cv. Jianxi) accumulates high concentrations of Al in the leaves without showing any toxicity. To understand the accumulation mechanism of Al in buckwheat, the distribution and mobility of Al in buckwheat were investigated. Relatively long-term treatment (28 d) with Al led to a decrease in Al concentration from old to young leaves, while a short-term (1 d) exposure to Al resulted in a uniform distribution of Al in the leaves. When the fourth leaf was wrapped inside a transparent plastic bag to suppress transpiration, the Al concentration of this leaf was only one-quarter of that in the corresponding leaf without wrapping. Within a leaf, the Al concentration at the margins was much higher than that in the centre. These results indicate that Al distribution in the leaves is controlled by both rate and duration of transpiration. The mobility of Al between old and new leaves was studied by first growing plants in a solution with Al, followed by culture in a solution without Al. The Al content in the two new leaves appeared after removal of external Al was very low, whereas that in the old leaves did not decrease but continued to increase. The increased Al content was found to be translocated from Al remaining in the roots. It is concluded that Al is not mobile once it is accumulated in the leaf.

Adaptation, Physiological↗
PubMed2000

Identification and characterization of two androgen response regions in the human neutral endopeptidase gene.

Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.

Androgens↗
PubMed2000

Neutral endopeptidase promotes phorbol ester-induced apoptosis in prostate cancer cells by inhibiting neuropeptide-induced protein kinase C delta degradation.

Phorbol esters induce apoptosis in androgen-sensitive LNCaP cells, which express neutral endopeptidase (NEP), but not in androgen-independent prostate cancer (PC) cells, which lack NEP expression. We investigated the role of NEP in PC cell susceptibility to 12-O-tetradecanoylphorbol-13-acetate (TPA). Western analysis showed that expression of NEP and protein kinase Cdelta (PKCdelta) correlated with PC cell sensitivity to TPA-induced growth arrest and apoptosis in LNCaP cells and in TSU-Prl cells expressing an inducible wild-type NEP protein. Inhibition of NEP enzyme activity using the specific NEP inhibitor CGS24592, or inhibition of PKCdelta using Rottlerin at concentrations that inhibit PKCdelta but not PKCalpha, significantly inhibited TPA-induced growth inhibition and cell death. Furthermore, pulse-chase experiments showed PKCdelta is stabilized in LNCaP cells and in TSU-Pr1 cells overexpressing wild-type NEP compared with PC cells lacking NEP expression. This results from NEP inactivation of its neuropeptide substrates (bombesin and endothelin-1), which in the absence of NEP stimulate cSrc kinase activity and induce rapid degradation of PKCdelta protein. These results indicate that expression of enzymatically active NEP by PC cells is necessary for TPA-induced apoptosis, and that NEP inhibits neuropeptide-induced, cSrc-mediated PKCdelta degradation.

Amino Acid Sequence↗
PubMed2000

The protein tyrosine phosphatase Shp-2 regulates RhoA activity.

Remodeling of filamentous actin into distinct arrangements is precisely controlled by members of the Rho family of small GTPases [1]. A well characterized member of this family is RhoA, whose activation results in reorganization of the cytoskeleton into thick actin stress fibers terminating in integrin-rich focal adhesions [2]. Regulation of RhoA is required to maintain adhesion in stationary cells, but is also critical for cell spreading and migration [3]. Despite its biological importance, the signaling events leading to RhoA activation are not fully understood. Several independent studies have implicated tyrosine phosphorylation as a critical event upstream of RhoA [4]. Consistent with this, our recent studies have demonstrated the existence of a protein tyrosine phosphatase (PTPase), sensitive to the dipeptide aldehyde calpeptin, acting upstream of RhoA [5]. Here we identify the SH2 (Src homology region 2)-containing PTPase Shp-2 as a calpeptin-sensitive PTPase, and show that calpeptin interferes with the catalytic activity of Shp-2 in vitro and with Shp-2 signaling in vivo. Finally, we show that perturbation of Shp-2 activity by a variety of genetic manipulations results in raised levels of active RhoA. Together, these studies identify Shp-2 as a PTPase acting upstream of RhoA to regulate its activity and contribute to the coordinated control of cell movement.

Animals↗