PubMed Health⌕ Search

Biomedical subjects

R W Baird

Publications and source records attributed to R W Baird.

At least 19 recordsLinked to original sources
PubMed2001

Quality improvement efforts in the intensive care unit: development of a new heparin protocol.

CONTEXT: An ongoing process of identifying and implementing breakthrough projects to quickly improve patient outcomes and reduce costs in the intensive care unit. OBJECTIVE: To develop and test a new protocol for heparin administration in the intensive care unit, replacing the 5 existing protocols and ensuring compliance with the recommendations of the Fifth American College of Chest Physicians Consensus Conference on Antithrombotic Therapy. DESIGN: A pilot study comparing results of 58 patients on the 5 existing protocols with those of 10 patients on the new heparin protocol. SETTING: Baylor University Medical Center, a large tertiary hospital in Dallas, Texas, with 115 adult intensive care unit beds. INTERVENTIONS: Heparin dosing was based on a patient's weight, and anticoagulation was monitored through the heparin assay. MAIN OUTCOME MEASURES: In the control group treated according to the existing protocols, 5 patients (8.6%) received optimal bolus doses, and 2 patients (3.4%) received optimal infusion doses. In the pilot group treated according to the new protocols, 9 patients (90%) received optimal bolus doses, and all received optimal infusion doses. RESULTS: The implementation of the new heparin protocol resulted in better patient care, improved nursing efficiency, and reduced costs. CONCLUSIONS: As shown in this example, a rapid breakthrough project following a plan-do-study-act cycle can apply best practices relatively quickly and lead to better patient outcomes.

Journal Article↗
PubMed1999

Dermatophyte infections in Melbourne: trends from 1961/64 to 1995/96.

A comparison of dermatophyte infections, diagnosed by specimens sent to the laboratory, between 1961/64 and 1995/96 revealed two major trends, namely the site of clinical disease and the types of dermatophytes causing tinea infections. There was a marked decrease in scalp specimens submitted. Pedal disease and nail infections remained the predominant entities. There was a marked increase in Trichophyton rubrum isolations, such that T. rubrum now accounts for 69.5% of all dermatophyte infections. Possible causes for these trends include altered hygiene standards, changing immigration patterns and the availability, restrictions and diagnostic requirements for the prescription of various antifungal drugs over this time period.

Adolescent↗
PubMed1999

A fluffy white traveller: imported Coccidiodes immitis infection in an Australian tourist.

Pulmonary coccidioidomycosis is a rare cause of pulmonary nodules and respiratory infection in travellers to endemic areas. An Australian tourist suffered an acute respiratory illness while on holiday in Mexico. She subsequently developed erythema nodosum and was noted to have a left pulmonary nodule on chest X-ray after return to Australia. The diagnosis of Coccidioides immitis infection was established by histology and culture of the resected lung lesion. The patient made an uneventful recovery and received one month of therapy with ketoconazole. Culture of the fungus took place under controlled Class 3 conditions. An unusual fungal infection in Australia, coccidioidomycosis poses special risks to staff of microbiology laboratories.

Adult↗
PubMed1999

Gastroenteritis in adults. New aspects of diagnosis and treatment.

BACKGROUND: Gastroenteritis is common, usually self limited and does not require laboratory investigation. OBJECTIVE: This article examines current aspects of clinical diagnosis, the incidence of pathogens, laboratory investigations, and therapies. DISCUSSION: Investigation of patients with gastroenteritis is more appropriate at the extremes of age and in selected patient groups. Empiric therapy of presumptive invasive bacterial gastroenteritis shortens the duration of symptoms and limits bacterial excretion.

Adult↗
PubMed1996

Genetic variation in Australian spotted fever group rickettsiae.

Rickettsiae were isolated by cell culture of buffy coat blood from six patients with spotted fever from southeastern Australia and Flinders Island in Bass Strait. The isolates were genetically compared with two previous Rickettsia australis patient isolates. The genus-specific 17-kDA genes from the isolates were compared after DNA amplification and restriction fragment analysis of the amplified DNA. This comparison revealed that mainland rickettsial isolates from southeastern Australia were identical to two previous isolates of R. australis from northeastern Australia. Rickettsial isolates from Flinders Island were distinct from the mainland isolates. The 16S rRNA gene sequences from the isolates were determined and compared. The Flinders Island rickettsial agent was most closely related (0.3% structural divergence) to Rickettsia rickettsii, Rickettsia conorii, and Rickettsia slovaca. The Flinders Island rickettsial agent was 1.3 and 2.1% structurally divergent from R. australis and Rickettsia akari, respectively. The 16S rRNA gene sequence from the Flinders Island agent shows that this rickettsia is more closely related to the rickettsial spotted fever group than is R. australis. We conclude that there are two populations of spotted fever group rickettsiae in Australia and propose that the genetically distinct causative organism of Flinders Island spotted fever be designated Rickettsia honei. The extent of distribution and animal host reservoirs remain to be elucidated.

Adult↗
PubMed1995

In vitro growth of the microsporidian Septata intestinalis from an AIDS patient with disseminated illness.

A new species of microsporidian, Septata intestinalis, was recently recognized as an opportunistic pathogen of AIDS patients. In this study, it was cultured from the nasopharyngeal aspirate of a human immunodeficiency virus type 1-infected patient with disseminated microsporidiosis. In human embryonic lung cells exposed to S. intestinalis, a cytopathic effect appeared within 28 days as foci of rounded up cells. Thin-section electron microscopy showed a variety of developmental stages of the microsporidium within parasitophorous vacuoles. In monocyte-derived macrophages, evidence of infection and development of the parasite was demonstrated by light and electron microscopy. In both infected human embryonic lung cells and monocyte-derived macrophages, a network of septa separated individual spores. Partial sequencing of the RNA small-subunit gene (16S rDNA gene) confirmed the identity of this parasite as S. intestinalis. This is the first report of the isolation of S. intestinalis in vitro and provides evidence that the parasite can be disseminated by macrophages.

AIDS-Related Opportunistic Infections↗
PubMed1994

Comparison of Pneumocystis carinii detection by toluidine blue O staining, direct immunofluorescence and DNA amplification in sputum specimens from HIV positive patients.

Pneumocystis carinii pneumonia (PCP) is the commonest opportunistic infection in AIDS patients. By using the polymerase chain reaction (PCR), specific DNA sequences can be amplified and used in diagnosis of infections such as PCP where the causative pathogen is both difficult to grow and present in low numbers. Twenty HIV positive patients were investigated for PCP. Twenty sputa (15 induced and 5 expectorated) had toluidine blue O staining, direct immunofluorescence and PCR performed for Pneumocystis carinii in a blinded fashion. PCR was performed using primers pAZ102-E 5' GATGGCTGTTTCCAAGCCCA 3' and pAZ102-H 5' GTGTACGTTGCAAAGTACTC 3' from the gene coding for Pneumocystis carinii mitochondrial ribosomal RNA with a specific 346 base-pair sequence being amplified from positive specimens. Ten of the patients had Pneumocystis carinii shown by conventional tests and PCR. Another 3 patients were positive only by PCR, all had evidence of infection with Pneumocystis carinii; the first was positive by subsequent conventional stains, the second was treated for bacterial bronchitis but had a non-resolving chest infection with PCP found on postmortem after 4 mths, the third had a typical interstitial infiltrate on CXR and responded to empiric PCP treatment. PCR is more sensitive than toluidine blue O staining and direct immunofluorescence in detecting Pneumocystis carinii in sputum from HIV patients and may become the diagnostic method of choice for PCP.

AIDS-Related Opportunistic Infections↗
PubMed1994

Passive protection of mice against group A streptococcal pharyngeal infection by lipoteichoic acid.

Previous studies have shown that lipoteichoic acid (LTA) of group A streptococci plays a central role in the adherence of these organisms to epithelial cells. In this study, intranasal instillation of purified LTA but not deacylated LTA in mice blocked colonization and prevented death after intranasal challenge infection with group A streptococci. Bacteria pretreated with rabbit antisera against LTA also failed to colonize or infect mice after intranasal challenge. In vitro studies showed that LTA and M protein inhibited adherence of type 24 streptococci to mouse pharyngeal cells. Passive intranasal administration of purified type 24 M protein protected mice from death after challenge infection with type 24 streptococci but had no significant effect on pharyngeal colonization. Surface LTA and M protein may mediate adherence of streptococci to mouse pharyngeal cells, and blocking adherence with LTA prevents colonization and infection in this animal model.

Animals↗
PubMed1993

A new trichrome-blue stain for detection of microsporidial species in urine, stool, and nasopharyngeal specimens.

Detection of microsporidia in clinical specimens has relied on electron microscopy, histology, or staining. This article describes further alterations to the modified trichrome staining method which make it easier to identify microsporidial spores. The changes are a decrease in the phosphotungstic acid level and the substitution of a colorfast counterstain, aniline blue, for the fast green of the original stain. The modified stain provides good contrast between microsporidial spores and background material including human and fungal cells. Stool specimens from 139 human immunodeficiency virus-seropositive patients revealed that 5 patients were infected with Enterocytozoon bieneusi and 6 patients had larger spores. Thin-section electron microscopy of the larger spores showed a structure consistent with that of either Encephalitozoon or Septata species. Three of the patients with Encephalitozoon- or Septata-like species had disseminated infection, with spores detected in nasopharyngeal aspirates and urine samples.

AIDS-Related Opportunistic Infections↗
PubMed1992

Characterization and comparison of Australian human spotted fever group rickettsiae.

The microbiological and molecular characteristics of the rickettsiae isolated from humans with Queensland tick typhus (QTT) caused by Rickettsia australis and the recently described Flinders Island spotted fever (FISF) were compared. Clinically and serologically, the diseases are similar. Cell culture reveals differences in the plaque-forming abilities of the isolates. Characterization of the gene encoding the genus-specific 17-kDa antigen of R. australis revealed a unique nucleotide sequence unlike those of the FISF isolate and Rickettsia rickettsii. Southern blot analysis of rickettsial DNA from the isolates with a 17-kDa-antigen gene probe revealed the presence of this gene in all isolates but no difference in banding patterns. When a probe for the rRNA genes was used, clear differences in banding patterns of isolates from patients with QTT and FISF were revealed. Thus, the rickettsiae isolated from patients with FISF differ from those from patients with QTT and may represent a new rickettsial species.

Antigens, Bacterial↗
PubMed1991

Epitopes of group A streptococcal M protein shared with antigens of articular cartilage and synovium.

Rabbit antisera evoked by purified pepsin-extracted group A streptococcal M proteins were screened for the presence of joint cross-reactive antibodies by indirect immunofluorescence using thin sections of mouse knee joints. Pep M1, M5, and M18 antisera contained antibodies that cross-reacted with chondrocytes, cartilage, and synovium. Immunofluorescence inhibition assays showed that some of the joint cross-reactive epitopes were shared among the three heterologous serotypes of M protein. The pep M5 joint cross-reactive epitopes were localized to three different synthetic peptides of the C-terminal region of pep M5. Immunoblot analyses showed that the M5 joint cross-reactive antibodies recognized two proteins of human synovium and cartilage of molecular mass 56 and 58 kDa. The cross-reactive antibodies binding to the 56-kDa protein were inhibited by purified vimentin in immunoblot inhibition experiments. M protein-specific antibodies from patients with acute rheumatic fever were also shown to cross-react with joint tissue in a pattern similar to the rabbit antisera. Rabbit and human M protein-specific antibodies that were bound to articular cartilage activated significant levels of complement when compared to control serum, suggesting that M protein joint cross-reactive antibodies could potentially be involved in the pathogenesis of ARF and arthritis.

Antibodies, Bacterial↗