PubMed Health⌕ Search

Biomedical subjects

R Zbinden

Publications and source records attributed to R Zbinden.

At least 55 records · Page 3Linked to original sources
PubMed1998

Serological evidence of human granulocytic ehrlichiosis in Switzerland.

To investigate whether human granulocytic ehrlichiosis (HGE) is prevalent in Switzerland, 1515 human serum samples from individuals with different risks for tick exposure were tested for antibodies to Ehrlichia phagocytophila, a surrogate marker of the agent of HGE. The distribution of titres showed marked differences between sera of individuals with no or low risk for tick exposure and those with a high risk. The results of serological testing provided evidence of HGE in Switzerland as well as evidence of two types of coinfections: those with the agent of HGE and Borrelia burgdorferi, and those with the agent of HGE and the central European tickborne encephalitis virus.

Antibodies, Bacterial↗
PubMed1998

IgM to Bartonella henselae in cat-scratch disease and during acute Epstein-Barr virus infection.

The diagnostic value of IgM to Bartonella henselae was evaluated in 20 children with cat-scratch disease (CSD) and controls consisting of 20 blood donors and 20 children with enlarged lymph nodes without CSD by two indirect immunofluorescence assays (IFA). One was based on B. henselae cocultivated with Vero cells (host cell-associated IFA), and the other on B. henselae grown on agar (host cell-free IFA). With the host cell-associated IFA, 18 of 20 children with CSD revealed IgM, whereas only 14 did so with the host cell-free IFA. Sera of two blood donors as well as sera from three children with enlarged lymph nodes without CSD showed also positive IgM to cell-associated B. henselae. This study reveals that the IFA applied had sensitivities of 70-90% and specificities of 87.5-100% for detecting IgM to B. henselae. Additionally, 20 patients with IgM to Epstein-Barr virus (EBV) capsid antigen were tested for IgM to B. henselae. Sera of 16 and 9 of these patients revealed IgM to B. henselae with the host cell-associated and the host cell-free IFA, respectively. Using Western blot these sera were demonstrated to react against linearized proteins of Vero cells and of B. henselae. Thus, since acute EBV infection may substantially reduce the specificity of B. henselae-specific IgM tests, we conclude that diagnosis of CSD should be confirmed by a significant IgG titer to B. henselae or by detection of this pathogen.

Animals↗
PubMed1998

Enteroaggregative Escherichia coli as a potential cause of diarrheal disease in adults infected with human immunodeficiency virus.

Stools of 68 human immunodeficiency virus (HIV)-infected adults with diarrhea and 60 without diarrhea were examined for enteroaggregative Escherichia coli (EAggEc) by HeLa cell adherence assay. EAggEc were present in stools of 30 patients with and 18 without diarrhea (P = .05). CD4 cell counts of patients with EAggEc and diarrhea were significantly lower than those of patients with EAggEc without diarrhea (P = .02). There was no difference in the mean duration of diarrheal symptoms or in the number of stools per day between patients with EAggEc and those without. None of the EAggEc strains were positive by polymerase chain reaction for adherence fimbria, but 11 strains were positive for EAggEc heat-stable toxin EAST/1. Of the EAggEc strains, 51% were resistant to trimethoprim-sulfamethoxazole and 65% were resistant to ampicillin. EAggEc may be a pathogen in HIV-infected patients with diarrhea; HIV-infected patients with EAggEc appear to be more symptomatic when HIV disease is more advanced.

AIDS-Related Opportunistic Infections↗
PubMed1998

Antibody response in six HACEK endocarditis cases under therapy.

The antibody response to bacteria of the so-called HACEK group, i.e. Haemophilus spp., Actinobacillus actinomycetemcomitans, Cardiobacterium hominis, Eikenella corrodens and Kingella kingae, was measured in sera of six patients with endocarditis. The corresponding isolates from their blood cultures were identified by conventional methods, including reactions for nitrate reduction and catalase as well as acid production from sugars. Crude antigens were prepared by glycine extraction and sonification of the blood culture isolates, and used to determine titers by complement fixation. A patient with Haemophilus parainfluenzae bacteremia received a short course of antibiotic therapy, and relapsed with spondylitis and endocarditis 5 months later. Titers of sera against his own isolate rose from 1:40 to 1:320 and fell to 1:40 after therapy within one year. A patient with C. hominis endocarditis had a similarly prolonged course. The complement fixation titer against his own isolate was already 1:240 before antibiotics were administered. Another patient with C. hominis endocarditis presented a titer of 1:320 2 weeks after the diagnosis. These three patients revealed C-reactive protein values over 50 mg/l in the first serum sample. Decrease of both antibody titers and C-reactive protein values correlated with clinical improvement. Two patients with prosthetic valve replacement 5 months earlier developed C. hominis and K. kingae endocarditis, respectively. At admission, C-reactive protein values were 64 and 82, respectively, and therapy was instituted immediately. The first sera were received 3 and 6 weeks, respectively, after isolation of the corresponding blood culture isolates and revealed already low titers, i. e. 1:80 and 1:60, respectively. A woman with A. actinomycetemcomitans endocarditis received immediate therapy and did not develop titers against her own isolate. CRP was 100 at admission and remained over 50 5 weeks later. We conclude that the complement fixation assay with individual antigen preparations was easy to perform and allowed monitoring of the antibody response in 5 of 6 HACEK endocarditis cases under therapy, but the usefulness of this method to find culture-negative HACEK endocarditis needs to be established.

Aged↗
PubMed1998

[Decreased penicillin sensitivity of pneumococci].

The mechanism of penicillin-resistance of Streptococcus pneumoniae involves the development of altered forms of penicillin-binding proteins (PBPs) that have a decreased affinity for penicillin. PBPs are involved in the assembly of the cell wall. Normal forms of PBPs are inhibited by penicillin but altered forms are not. It appears that the altered PBP genes arose by interspecies recombinational events in which segments of the PBPs structural genes had been replaced by regions derived from PBP genes of oral streptococcal species. Altered PBP genes of penicillin-resistant pneumococci can be spread horizontally to sensitive pneumococci by transformation. Highly resistant pneumococci have several altered PBPs and also show resistance to the third-generation cephalosporins and other antibiotics. Some clones of resistant pneumococci seem to have an increased epidemic potential to spread. In Austria, Germany, Italy, and Switzerland approximately 95% of pneumococci are still penicillin-sensitive. However, an increase of the highly resistant pneumococci would change the empirical therapy of severe pneumococcal infections in the near future. Reasonable use of antimicrobials might reduce the selective antimicrobial pressure and the spread of penicillin-resistant strains.

Child↗
PubMed1997

[Comparative effect of lansoprazole/amoxicillin with omeprazole/amoxicillin for the eradication of Helicobacter pylori in patients with duodenal ulcer].

Lansoprazole, a potent antisecretory drug, possesses on an equimolar basis a 4-fold higher in vitro anti-Helicobacter pylori activity than omeprazole. In a prospective randomized study we compared lansoprazole 30 mg b.i.d. and amoxicillin 1 g b.i.d. with omeprazole 40 mg b.i.d. and amoxicillin 1 g b.i.d. for 14 days followed by lansoprazole 30 mg q.d. or omeprazole 20 mg q.d. for 14 additional days in 50 H. pylori positive duodenal ulcer patients (14f, 36m, age 27-83 [mean 43] years). H. pylori infection was diagnosed by histology (3 antral biopsies and 2 from gastric body, H & E- and Giemsa stain), rapid urease test (CLO) and culture in 39 patients, or by histology and rapid urease test in 11 patients. Control endoscopy was performed 4-6 weeks after the end of treatment. For eradication, a negative result in all 3 diagnostic modalities was required. The eradication rate was 43% (9/21 patients) in both treatment groups. 8 patients were lost to follow-up. The ulcer healing rate was 100% in both groups. Nonsmokers had a significantly higher (p = 0.026) eradication rate than smokers. No relevant adverse effects of the therapy occurred. 24 patients with persistent H. pylori infection were subsequently treated with lansoprazole 60 mg b.i.d. and amoxicillin 1 g b.i.d. for 14 days. Eradication was achieved in 5/22 (23%) patients (3/14 smokers, 2/8 nonsmokers), while 2 patients were lost to follow-up. 17 patients with persistent H. pylori infection after the second treatment received quadruple therapy consisting of metronidazole 500 mg t.i.d., tetracycline 500 mg q.i.d. bismuth-subcitrate 120 mg q.i.d. and lansoprazole 30 mg for 10 days. H. pylori eradication was achieved in 12/15 patients (80%). In conclusion, lansoprazole plus amoxicillin was equal to omeprazole plus amoxicillin in the treatment of H. pylori infected duodenal ulcer patients. Patients with eradication failure after dual therapy were successfully treated by quadruple therapy. In contrast, high dose lansoprazole and amoxicillin therapy was effective in only 23% of patients with persistent infection after standard dual therapy.

2-Pyridinylmethylsulfinylbenzimidazoles↗
PubMed1997

Evaluation of commercial slides for detection of immunoglobulin G against Bartonella henselae by indirect immunofluorescence.

Four commercial slides were compared with in-house slides for the detection of immunoglobulin G (IgG) against Bartonella henselae in 58 healthy persons from a rural region by an indirect immunofluorescence assay. MRL-BA slides (MRL Diagnostics, USA) and Virion slides (Virion, Switzerland) with agar-derived Bartonella henselae showed IgG titers of > or = 1:256 in 44.8% and 51.7%, respectively, whereas Bion slides (Bios, Germany), MRL-Vero slides (MRL Diagnostics), and in-house slides with cell-associated Bartonella henselae showed such titers in 3.4%, 5.1% and 3.4%, respectively. The MRL-Vero slides (Bartonella IgG substrate slides, MRL Diagnostics) were further evaluated with 26 patients with cat scratch disease, 20 patients with lymphadenopathy not due to cat scratch disease, 100 blood donors from an urban area, and 120 blood donors from a mixed urban/rural area. In our mixed urban/rural population the IgG titer of 1:256 had a sensitivity of 84.6% and a specificity of 93.4% for the serodiagnosis of cat scratch disease. Seroprevalence was higher in blood donors from the mixed area (50.8%) than from the urban area (37%). MRL-Vero slides were considered useful for the serodiagnosis of cat scratch disease by indirect immunofluorescence and have replaced our in-house system. However, patients with low IgG titers should be retested three to four weeks after initial sampling to demonstrate a possible rise of IgG titers in paired sera.

Antibodies, Bacterial↗
PubMed1997

Molecular diagnosis of bacterial endocarditis by broad-range PCR amplification and direct sequencing.

Broad-range PCR amplification of part of the 16S rRNA gene followed by single-strand sequencing was applied to samples of 18 resected heart valves from patients with infective endocarditis. The PCR results were compared with those of cultures of valves and with those of previous blood cultures. For two patients there was agreement with the cultures of the valves; for nine patients there was agreement with the previous blood cultures, which were positive, while the cultures of the valves were negative; a Streptococcus sp. and Tropheryma whippelii each were found in one patient with negative cultures (valve and blood); for two patients the cultures of the valves as well as the PCR results were negative but the blood cultures were positive; for one patient amplification was inhibited; and for two patients the PCR results were positive but the amplicons could not be sequenced. It is concluded that broad-range PCR is a promising tool for patients with culture-negative endocarditis and allows the detection of rare, noncultivable organisms.

Actinobacteria↗
PubMed1996

[Detection of Bartonella (Rochalimaea) henselae/B. quintana by polymerase chain reaction (PCR)].

Bartonella (Rochalimaea) henselae and/or B. quintana are the causative agents of a variety of infections such as trench fever, bacillary angiomatosis, septicemia, peliosis hepatis and endocarditis. Recently, B. henselae has been identified as a major cause of cat scratch disease. Diagnosis of such infections is based on clinical information, histopathology, culture and serology. However, none of these methods alone is sufficiently sensitive or specific. We have used the PCR to search for DNA specific for B. henselae/B. quintana in 33 clinical samples and in 6 controls. In comparison with clinical data and histopathology, PCR was extremely specific (100%) and reasonably sensitive (61%). Possible explanations for the limited sensitivity of PCR are discussed. We conclude that PCR provides a useful adjunct for the diagnosis of infections caused by B. henselae and B. quintana.

Bartonella Infections↗
PubMed1996

Discrimination of respiratory syncytial virus subgroups A and B by reverse transcription-PCR.

Reverse transcription (RT)-PCR with shared primers differentiating respiratory syncytial virus (RSV) subgroups A and B was developed for subtyping of RSV isolates. Results of RT-PCR were compared with those of an indirect immunofluorescence test using monoclonal antibodies. Viral RNA isolated from cell cultures infected with RSV served as a template for cDNA synthesis with random primers. For PCR, we used three synthetic oligonucleotides corresponding to the G protein mRNA sequence of subgroup A (bases 248 to 267; 3'ATGCAACAAGCCAGATCAAG), subgroup B (bases 314 to 333; 3'ACTCATCCAAACAACCCACA), or both (bases 511 to 530; 3'GGWACAAARTTGAACACTTC). PCR products of RSV subgroups A and B had molecular sizes of 283 and 217 bp, respectively. Specific cutting sites for RSV A and B in amplified cDNA were demonstrated by restriction fragment analysis with four restriction endonucleases. Our RT-PCR assay divided 68 RSV isolates into 47 strains of subgroup A and 21 strains of subgroup B in full agreement with subtyping by monoclonal antibodies. RT-PCR seems to be a good alternative to subtyping of RSV with monoclonal antibodies.

Antibodies, Monoclonal↗
PubMed1996

[Isolation of Corynebacterium diphtheriae subsp. belfanti from a cow with chronic active dermatitis].

Diphtheria is an acute communicable disease of man caused by C. diphtheriae. Pharyngeal and cutaneous forms are described, where from both toxigenic and nontoxigenic strains can be isolated. The occurrence of C. diphtheriae in dairy cattle has already been reported in the past. The pathogens were isolated from ulcerated teats and from the milk of cows with mastitis as well. These animals were considered to play a role in the transmission of the disease to man. This paper describes the isolation and characterization of C. diphtheriae in a 4 years old cow with generalized, partly ulcerative and purulent skin lesions. Bacteriological examination revealed the presence of very numerous corynebacterium-like organisms, which were characterized as C. diphtheriae subsp. belfanti, a nontoxigenic subspecies of C. diphtheriae. The significance of C. diphtheriae in veterinary medicine and the possible role of cattle as a reservoir of these organisms are discussed.

Animals↗
PubMed1995

Serology to Bartonella (Rochalimaea) henselae may replace traditional diagnostic criteria for cat-scratch disease.

Bartonella (Rochalimaea) henselae has been identified as causative agent of cat-scratch disease (CSD). Employing an indirect fluorescence antibody test we found that 20 (100%) out of 20 children with suspected CSD had serum titres to B. henselae of > or = 512. By contrast, in all but one of the controls (n = 332) including subjects exposed to the same cats, patients with diseases other than CSD, and blood donors the antibody titres were < or = 256 (P < 0.001). However, significant regional differences in seroprevalence were noted. CONCLUSION. Serology to B. henselae may supplant traditional criteria for the diagnosis of CSD and prevent patients from unnecessary surgery.

Adolescent↗
PubMed1995

Growth differences of Capnocytophaga canimorsus strains and some other fastidious organisms on various Columbia-based blood agar media.

Three human isolates of Capnocytophaga canimorsus from blood cultures showed no growth when cultivated on sheep blood agar plates based on BBL Columbia agar base, whereas the same three strains grew excellently on sheep blood agar plates based on Difco Columbia agar bases No. 2 or EH. Two of the three strains also grew well on blood agar plates based on bioMérieux Columbia agar. Strains that grew better on either Difco or bioMérieux Columbia based blood agar plates were found among Eikenella corrodens, Haemophilus aphrophilus, Kingella kingae, Lactobacillus sp., and Streptococcus adjacens, but these strains were never lost when cultivated on BBL Columbia agar plates. One strain of Lactobacillus failed to grow on Difco Columbia No. 2 agar and showed best growth on bioMérieux Columbia agar. Strains of Corynebacterium G 2, Corynebacterium afermentans and Streptococcus adjacens showed poor growth on chocolate agar when compared to blood agar media. Microbiologists should be aware of the importance of media formulations for optimal recovery of fastidious organisms.

Agar↗