Biomedical subjects

Roger A Garrett

Publications and source records attributed to Roger A Garrett.

At least 19 recordsLinked to original sources

PubMed2006

Crystallization and preliminary X-ray diffraction analysis of protein 14 from Sulfolobus islandicus filamentous virus (SIFV).

A large-scale programme has been embarked upon aiming towards the structural determination of conserved proteins from viruses infecting hyperthermophilic archaea. Here, the crystallization of protein 14 from the archaeal virus SIFV is reported. This protein, which contains 111 residues (MW 13 465 Da), was cloned and expressed in Escherichia coli with an N-terminal His(6) tag and purified to homogeneity. The tag was subsequently cleaved and the protein was crystallized using PEG 1000 or PEG 4000 as a precipitant. Large crystals were obtained of the native and the selenomethionine-labelled protein using sitting drops of 100-300 nl. Crystals belong to space group P6(2)22 or P6(4)22, with unit-cell parameters a = b = 68.1, c = 132.4 A. Diffraction data were collected to a maximum acceptable resolution of 2.95 and 3.20 A for the SeMet-labelled and native protein, respectively.

Cloning, Molecular↗

PubMed2006

Structural and genomic properties of the hyperthermophilic archaeal virus ATV with an extracellular stage of the reproductive cycle.

A novel virus, ATV, of the hyperthermophilic archaeal genus Acidianus has the unique property of undergoing a major morphological development outside of, and independently of, the host cell. Virions are extruded from host cells as lemon-shaped tail-less particles, after which they develop long tails at each pointed end, at temperatures close to that of the natural habitat, 85 degrees C. The extracellularly developed tails constitute tubes, which terminate in an anchor-like structure that is not observed in the tail-less particles. A thin filament is located within the tube, which exhibits a periodic structure. Tail development produces a one half reduction in the volume of the virion, concurrent with a slight expansion of the virion surface. The circular, double-stranded DNA genome contains 62,730 bp and is exceptional for a crenarchaeal virus in that it carries four putative transposable elements as well as genes, which previously have been associated only with archaeal self-transmissable plasmids. In total, it encodes 72 predicted proteins, including 11 structural proteins with molecular masses in the range of 12 to 90 kDa. Several of the larger proteins are rich in coiled coil and/or low complexity sequence domains, which are unusual for archaea. One protein, in particular P800, resembles an intermediate filament protein in its structural properties. It is modified in the two-tailed, but not in the tail-less, virion particles and it may contribute to viral tail development. Exceptionally for a crenarchaeal virus, infection with ATV results either in viral replication and subsequent cell lysis or in conversion of the infected cell to a lysogen. The lysogenic cycle involves integration of the viral genome into the host chromosome, probably facilitated by the virus-encoded integrase and this process can be interrupted by different stress factors.

Acidianus↗

PubMed2006

Evolutionary genomics of archaeal viruses: unique viral genomes in the third domain of life.

In terms of virion morphology, the known viruses of archaea fall into two distinct classes: viruses of mesophilic and moderately thermophilic Eueryarchaeota closely resemble head-and-tail bacteriophages whereas viruses of hyperthermophilic Crenarchaeota show a variety of unique morphotypes. In accord with this distinction, the sequenced genomes of euryarchaeal viruses encode many proteins homologous to bacteriophage capsid proteins. In contrast, initial analysis of the crenarchaeal viral genomes revealed no relationships with bacteriophages and, generally, very few proteins with detectable homologs. Here we describe a re-analysis of the proteins encoded by archaeal viruses, with an emphasis on comparative genomics of the unique viruses of Crenarchaeota. Detailed examination of conserved domains and motifs uncovered a significant number of previously unnoticed homologous relationships among the proteins of crenarchaeal viruses and between viral proteins and those from cellular life forms and allowed functional predictions for some of these conserved genes. A small pool of genes is shared by overlapping subsets of crenarchaeal viruses, in a general analogy with the metagenome structure of bacteriophages. The proteins encoded by the genes belonging to this pool include predicted transcription regulators, ATPases implicated in viral DNA replication and packaging, enzymes of DNA precursor metabolism, RNA modification enzymes, and glycosylases. In addition, each of the crenarchaeal viruses encodes several proteins with prokaryotic but not viral homologs, some of which, predictably, seem to have been scavenged from the crenarchaeal hosts, but others might have been acquired from bacteria. We conclude that crenarchaeal viruses are, in general, evolutionarily unrelated to other known viruses and, probably, evolved via independent accretion of genes derived from the hosts and, through more complex routes of horizontal gene transfer, from other prokaryotes.

Amino Acid Sequence↗

PubMed2006

Viruses of the Archaea: a unifying view.

DNA viruses of the Archaea have highly diverse and often exceptionally complex morphotypes. Many have been isolated from geothermally heated hot environments, raising intriguing questions about their origins, and contradicting the widespread notion of limited biodiversity in extreme environments. Here, we provide a unifying view on archaeal viruses, and present them as a particular assemblage that is fundamentally different in morphotype and genome from the DNA viruses of the other two domains of life, the Bacteria and Eukarya.

Archaea↗

PubMed2006

Mutations and rearrangements in the genome of Sulfolobus solfataricus P2.

The genome of Sulfolobus solfataricus P2 carries a larger number of transposable elements than any other sequenced genome from an archaeon or bacterium and, as a consequence, may be particularly susceptible to rearrangement and change. In order to gain more insight into the natures and frequencies of different types of mutation and possible rearrangements that can occur in the genome, the pyrEF locus was examined for mutations that were isolated after selection with 5-fluoroorotic acid. About two-thirds of the 130 mutations resulted from insertions of mobile elements, including insertion sequence (IS) elements and a single nonautonomous mobile element, SM2. For each of these, the element was identified and shown to be present at its original genomic position, consistent with a progressive increase in the copy numbers of the mobile elements. In addition, several base pair substitutions, as well as small deletions, insertions, and a duplication, were observed, and about one-fifth of the mutations occurred elsewhere in the genome, possibly in an orotate transporter gene. One mutant exhibited a 5-kb genomic rearrangement at the pyrEF locus involving a two-step IS element-dependent reaction, and its boundaries were defined using a specially developed "in vitro library" strategy. Moreover, while searching for the donor mobile elements, evidence was found for two major changes that had occurred in the genome of strain P2, one constituting a single deletion of about 4% of the total genome (124 kb), while the other involved the inversion of a 25-kb region. Both were bordered by IS elements and were inferred to have arisen through recombination events. The results underline the caution required in working experimentally with an organism such as S. solfataricus with a continually changing genome.

Archaeal Proteins↗

PubMed2006

A putative viral defence mechanism in archaeal cells.

Clusters of regularly spaced direct repeats, separated by unconserved spacer sequences, are ubiquitous in archaeal chromosomes and occur in some plasmids. Some clusters constitute around 1% of chromosomal DNA. Similarly structured clusters, generally smaller, also occur in some bacterial chromosomes. Although early studies implicated these clusters in segregation/partition functions, recent evidence suggests that the spacer sequences derive from extrachromosomal elements, and, primarily, viruses. This has led to the proposal that the clusters provide a defence against viral propagation in cells, and that both the mode of inhibition of viral propagation and the mechanism of adding spacer-repeat units to clusters, are dependent on RNAs transcribed from the clusters. Moreover, the putative inhibitory apparatus (piRNA-based) may be evolutionarily related to the interference RNA systems (siRNA and miRNA), which are common in eukarya. Here, we analyze all the current data on archaeal repeat clusters and provide some new insights into their diverse structures, transcriptional properties and mode of structural development. The results are consistent with larger cluster transcripts being processed at the centers of the repeat sequences and being further trimmed by exonucleases to yield a dominant, intracellular RNA species, which corresponds approximately to the size of a spacer. Furthermore, analysis of the extensive clusters of Sulfolobus solfataricus strains P1 and P2B provides support for the presence of a flanking sequence adjoining a cluster being a prerequisite for the incorporation of new spacer-repeat units, which occurs between the flanking sequence and the cluster. An archaeal database summarizing the data will be maintained at http://dac.molbio.ku.dk/dbs/SRSR/.

Archaea↗

PubMed2005

Viruses of hyperthermophilic Crenarchaea.

Since the discovery of the Archaea--the third domain of life--by Woese and colleagues in 1977, the subsequent developments in molecular and cell biology, and also genomics, have strongly reinforced the view that archaea and eukarya co-evolved, separately from bacteria, over a long time. However, when one examines the archaeal viruses, the picture appears complex. Most viruses that are known to infect members of the kingdom Euryarchaeota resemble bacterial viruses, whereas those associated with the kingdom Crenarchaeota show little resemblance to either bacterial or eukaryal viruses. This review summarizes our current knowledge of this group of exceptional and highly diverse archaeal viruses.

Archaeal Viruses↗

PubMed2005

Virology: independent virus development outside a host.

Viruses are thought to be functionally inactive once they are outside and independent of their host cell. Here we describe an exceptional property of a newly discovered virus that infects a hyperthermophilic archaeon growing in acidic hot springs: the lemon-shaped viral particle develops a very long tail at each of its pointed ends after being released from its host cell. The process occurs only at the temperature of the host's habitat (75-90 degrees C) and it does not require the presence of the host cell, an exogenous energy source or any cofactors. This host-independent morphological development may be a strategy for viral survival in an environment that is unusually harsh and has limited host availability.

Acidianus↗

PubMed2005

A novel rudivirus, ARV1, of the hyperthermophilic archaeal genus Acidianus.

Virus ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli, Italy. The rod-shaped virions, 610 +/- 50 nm long and 22 +/- 3 nm wide, are non-enveloped and carry a helical nucleoprotein core, with three tail fibers protruding at each end which appear to be involved in adsorption onto the host cell surface. The virions contain two protein components, a major one of 14.4 kDa, which is glycosylated and a minor of about 124 kDa. The linear double-stranded DNA genome yielded 24,655 bp of sequence, including 1365 bp inverted terminal repeats. Coding is on both strands and about 40% of the predicted genes are homologous to those of other hyperthermophilic crenarchaeal viruses, mainly rudiviruses. They include genes encoding the coat protein, two glycosyl transferases and a Holliday junction resolvase. Other assigned functions include a thymidylate synthase and three DNA-binding proteins. The genome sequence and composition differ strongly from those of the Sulfolobus rudiviruses SIRV1 and SIRV2, and the genome stability is very high, with no sequence variants being detected. Although the sequences of the inverted terminal repeats of the three rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends which may constitute a signal for the Holliday junction resolvase and DNA replication.

Acidianus↗

PubMed2005

Divergent transcriptional and translational signals in Archaea.

Many Archaea, in contrast to bacteria, produce a high proportion of leaderless transcripts, show a wide variation in their consensus Shine-Dalgarno (S-D) sequences and frequently use GUG and UUG start codons. In order to understand the basis for these differences, 18 complete archaeal genomes were examined for sequence signals that are positionally conserved upstream from genes. These functional motifs include box A promoter sequences for leaderless transcripts and S-D sequences for transcripts with leaders. Most of the box A sequences were preceded by a BRE-like motif and followed by a previously undetected A/T peak centred on position -10. Moreover, the sequence of the predominant S-D motifs in an archaeon is shown to depend on the precise number of nucleotides between the conserved anti-S-D CCUCC sequence and the 3'-terminal nucleotide of 16S RNA. Correlations with phylogenetic trees, constructed for the 18 Archaea, reveal that usage of high levels of both S-D motifs, and GUG and UUG start codons occurs exclusively in the shorter branched Archaea. High levels of leaderless transcripts are found in the longer branched Archaea.

Archaea↗

PubMed2005

Structure and genome organization of AFV2, a novel archaeal lipothrixvirus with unusual terminal and core structures.

A novel filamentous virus, AFV2, from the hyperthermophilic archaeal genus Acidianus shows structural similarity to lipothrixviruses but differs from them in its unusual terminal and core structures. The double-stranded DNA genome contains 31,787 bp and carries eight open reading frames homologous to those of other lipothrixviruses, a single tRNA(Lys) gene containing a 12-bp archaeal intron, and a 1,008-bp repeat-rich region near the center of the genome.

Genome, Viral↗

PubMed2005

The genome of Sulfolobus acidocaldarius, a model organism of the Crenarchaeota.

Sulfolobus acidocaldarius is an aerobic thermoacidophilic crenarchaeon which grows optimally at 80 degrees C and pH 2 in terrestrial solfataric springs. Here, we describe the genome sequence of strain DSM639, which has been used for many seminal studies on archaeal and crenarchaeal biology. The circular genome carries 2,225,959 bp (37% G+C) with 2,292 predicted protein-encoding genes. Many of the smaller genes were identified for the first time on the basis of comparison of three Sulfolobus genome sequences. Of the protein-coding genes, 305 are exclusive to S. acidocaldarius and 866 are specific to the Sulfolobus genus. Moreover, 82 genes for untranslated RNAs were identified and annotated. Owing to the probable absence of active autonomous and nonautonomous mobile elements, the genome stability and organization of S. acidocaldarius differ radically from those of Sulfolobus solfataricus and Sulfolobus tokodaii. The S. acidocaldarius genome contains an integrated, and probably encaptured, pARN-type conjugative plasmid which may facilitate intercellular chromosomal gene exchange in S. acidocaldarius. Moreover, it contains genes for a characteristic restriction modification system, a UV damage excision repair system, thermopsin, and an aromatic ring dioxygenase, all of which are absent from genomes of other Sulfolobus species. However, it lacks genes for some of their sugar transporters, consistent with it growing on a more limited range of carbon sources. These results, together with the many newly identified protein-coding genes for Sulfolobus, are incorporated into a public Sulfolobus database which can be accessed at http://dac.molbio.ku.dk/dbs/Sulfolobus.

Base Sequence↗

PubMed2005

Viral diversity in hot springs of Pozzuoli, Italy, and characterization of a unique archaeal virus, Acidianus bottle-shaped virus, from a new family, the Ampullaviridae.

Virus-like particles with five different morphotypes were observed in an enriched environmental sample from a hot, acidic spring (87 to 93 degrees C, pH 1.5) in Pozzuoli, Italy. The morphotypes included rigid rods, flexible filaments, and novel, exceptional forms. Particles of each type were isolated, and they were shown to represent viable virions of five novel viruses which infect members of the hyperthermophilic archaeal genus Acidianus. One of these, named the Acidianus bottle-shaped virus, ABV, exhibits a previously unreported morphotype. The bottle-shaped virion carries an envelope which encases a funnel-shaped core. The pointed end of the virion is likely to be involved in adsorption and channeling of viral DNA into host cells. The broad end exhibits 20 (+/- 2) thin filaments which appear to be inserted into a disk, or ring, and are interconnected at their bases. These filaments are apparently not involved in adsorption. ABV virions contain six proteins in the size range 15 to 80 kDa and a 23.9-kb linear, double-stranded DNA genome. Virus replication does not cause lysis of host cells. On the basis of its unique morphotype and structure, we propose to assign ABV to a new viral family, the Ampullaviridae.

Acidianus↗

PubMed2005

Novel RepA-MCM proteins encoded in plasmids pTAU4, pORA1 and pTIK4 from Sulfolobus neozealandicus.

Three plasmids isolated from the crenarchaeal thermoacidophile Sulfolobus neozealandicus were characterized. Plasmids pTAU4 (7,192 bp), pORA1 (9,689 bp) and pTIK4 (13,638 bp) show unusual properties that distinguish them from previously characterized cryptic plasmids of the genus Sulfolobus. Plasmids pORA1 and pTIK4 encode RepA proteins, only the former of which carries the novel polymerase-primase domain of other known Sulfolobus plasmids. Plasmid pTAU4 encodes a mini-chromosome maintenance protein homolog and no RepA protein; the implications for DNA replication are considered. Plasmid pORA1 is the first Sulfolobus plasmid to be characterized that does not encode the otherwise highly conserved DNA-binding PlrA protein. Another encoded protein appears to be specific for the New Zealand plasmids. The three plasmids should provide useful model systems for functional studies of these important crenarchaeal proteins.

Amino Acid Motifs↗

PubMed2004

Morphology and genome organization of the virus PSV of the hyperthermophilic archaeal genera Pyrobaculum and Thermoproteus: a novel virus family, the Globuloviridae.

A novel virus, termed Pyrobaculum spherical virus (PSV), is described that infects anaerobic hyperthermophilic archaea of the genera Pyrobaculum and Thermoproteus. Spherical enveloped virions, about 100 nm in diameter, contain a major multimeric 33-kDa protein and host-derived lipids. A viral envelope encases a superhelical nucleoprotein core containing linear double-stranded DNA. The PSV infection cycle does not cause lysis of host cells. The viral genome was sequenced and contains 28337 bp. The genome is unique for known archaeal viruses in that none of the genes, including that encoding the major structural protein, show any significant sequence matches to genes in public sequence databases. Exceptionally for an archaeal double-stranded DNA virus, almost all the recognizable genes are located on one DNA strand. The ends of the genome consist of 190-bp inverted repeats that contain multiple copies of short direct repeats. The two DNA strands are probably covalently linked at their termini. On the basis of the unusual morphological and genomic properties of this DNA virus, we propose to assign PSV to a new viral family, the Globuloviridae.

Archaeal Viruses↗

PubMed2004

Multiple variants of the archaeal DNA rudivirus SIRV1 in a single host and a novel mechanism of genomic variation.

The DNA rudivirus SIRV1 of the hyperthermophilic archaeon Sulfolobus shows exceptional properties. Viral isolates invariably contain a population of variants with different but closely related genomes. Upon propagation in a given host strain, one or more genomes dominate in the viral population. However, upon passage into a new host strain the viral population undergoes changes and other dominant variants are selected. Sequencing and analysis of the variant genomes revealed that major differences occur in gene order, gene size and gene content at localized genomic sites. A previously unknown mechanism of genomic rearrangement involving putative 12 bp archaeal introns appears to facilitate alteration of the variant genomes. Inter-genomic recombination between the different variants also occurs. The variant genomes exhibit signature tetranucleotide sequences near their putative sites for replication initiation.

Base Sequence↗

PubMed2004

Genomic comparison of archaeal conjugative plasmids from Sulfolobus.

All of the known self-transmissable plasmids of the Archaea have been found in the genus Sulfolobus. To gain more insight into archaeal conjugative processes, four newly isolated self-transmissable plasmids, pKEF9, pHVE14, pARN3 and pARN4, were sequenced and subjected to a comparative sequence analysis with two earlier sequenced plasmids, pNOB8 and pING1. The analyses revealed three conserved and functionally distinct sections in the genomes. Section A is considered to encode the main components of the conjugative apparatus, where two genes show low but significant sequence similarity to sections of genes encoding bacterial conjugative proteins. A putative origin of replication is located in section B, which is highly conserved in sequence and contains several perfect and imperfect direct and inverted repeats. Further downstream, in section C, an operon encoding six to nine smaller proteins is implicated in the initiation and regulation of replication. Each plasmid carries an integrase gene of the type that does not partition on integration, and there is strong evidence for their integration into host chromosomes, where they may facilitate intercellular exchange of chromosomal genes. Two plasmids contain hexameric short regularly spaced repeats (SRSR), which have been implicated in plasmid maintenance, and each plasmid carries multiple recombination motifs, concentrated in the variable regions, which likely provide sites for genomic rearrangements.

Base Sequence↗

PubMed2003

AFV1, a novel virus infecting hyperthermophilic archaea of the genus acidianus.

We describe a novel virus, AFV1, of the hyperthermophilic archaeal genus Acidianus. Filamentous virions are covered with a lipid envelope and contain at least five different proteins with molecular masses in the range of 23-130 kDa and a 20.8-kb-long linear double-stranded DNA. The virus has been assigned to the family Lipothrixviridae on the basis of morphotypic characteristics. Host range is confined to several strains of Acidianus and the virus persists in its hosts in a stable carrier state. The latent period of virus infection is about 4 h. Viral DNA was sequenced and sequence similarities were found to the lipothrixvirus SIFV, the rudiviruses SIRV1 and SIRV2, as well as to conjugative plasmids and chromosomes of the genus Sulfolobus. Exceptionally for the linear genomes of archaeal viruses, many short direct repeats, with the sequence TTGTT or close variants thereof, are closely clustered over 300 bp at each end of the genome. They are reminiscent of the telomeric ends of linear eukaryal chromosomes.

Acidianus↗