PubMed Health⌕ Search

Biomedical subjects

S Chandrasekaran

Publications and source records attributed to S Chandrasekaran.

At least 19 recordsLinked to original sources
PubMed1999

Catalytic Aerobic Oxidation of Cycloalkanes with Nanostructured Amorphous Metals and Alloys.

Under mild conditions (40 atm O(2), 28 degrees C, 10-15 h), an efficient aerobic oxidation of cycloalkanes to cycloalkanols can be achieved using nanostructured amorphous metals such as Fe and Co and an amorphous alloy like Fe(20)Ni(80) as catalysts. For example, cyclohexane is oxidized to cyclohexanol with 32-41 % conversion, while 1-adamantanol is formed from adamantane with 52-57 % conversion.

Journal Article↗
PubMed1999

Relation between infarct artery patency at late angiography after acute myocardial infarction and signal-averaged electrocardiography.

The angiograms of 89 patients were reviewed from the LATE Ancillary Study (randomized trial of recombinant tissue plasminogen activator vs placebo in patients with symptom onset after 6 hours of myocardial infarction) to determine patency of the infarct-related artery (IRA). In the occluded IRA group (n = 35), the incidence of signal-averaged electrocardiographic abnormality (fQRS > 120 ms) was significantly higher (p = 0.04), the filtered QRS duration was significantly longer (p = 0.007), and the V40 was significantly shorter (p = 0.02), compared with the patent IRA group (n = 54).

Adult↗
PubMed1999

Pro-adhesive and chemotactic activities of thrombospondin-1 for breast carcinoma cells are mediated by alpha3beta1 integrin and regulated by insulin-like growth factor-1 and CD98.

Thrombospondin-1 (TSP1) is a matricellular protein that displays both pro- and anti-adhesive activities. Binding to sulfated glycoconjugates mediates most high affinity binding of soluble TSP1 to MDA-MB-435 cells, but attachment and spreading of these cells on immobilized TSP1 is primarily beta1 integrin-dependent. The integrin alpha3beta1 is the major mediator of breast carcinoma cell adhesion and chemotaxis to TSP1. This integrin is partially active in MDA-MB-435 cells but is mostly inactive in MDA-MB-231 and MCF-7 cells, which require beta1 integrin activation to induce spreading on TSP1. Integrin-mediated cell spreading on TSP1 is accompanied by extension of filopodia containing beta1 integrins. TSP1 binding activity of the alpha3beta1 integrin is not stimulated by CD47-binding peptides from TSP1 or by protein kinase C activation, which activate alphavbeta3 integrin function in the same cells. In MDA-MB-231 but not MDA-MB-435 cells, this integrin is activated by pertussis toxin, whereas serum, insulin, insulin-like growth factor-1, and ligation of CD98 increase activity of this integrin in both cell lines. Serum stimulation is accompanied by increased surface expression of CD98, whereas insulin-like growth factor-1 does not increase CD98 expression. Thus, the pro-adhesive activity of TSP1 for breast carcinoma cells is controlled by several signals that regulate activity of the alpha3beta1 integrin.

Antigens, CD↗
PubMed1999

Efficacy of bretylium tosylate for ventricular tachycardia.

In 20 patients with inducible ventricular tachycardia (VT), intravenous bretylium tosylate infused as a 10-mg/kg bolus followed by 2 mg/min caused no change in refractory periods and did not suppress inducibility of VT. The use of bretylium for the treatment of VT should be reexamined.

Anti-Arrhythmia Agents↗
PubMed1998

Transfer and expression of a multiple antibiotic resistance plasmid in marine bacteria.

Conjugal transfer of a multiresistance plasmid from Pseudomonas fluorescens to halophilic and halotolerant bacteria was studied under in vitro and in situ conditions. Mating conducted in broth as well as on plates yielded a plasmid transfer frequency of as high as 10(-3). Among these two, plate mating facilitated conjugal transfer of plasmid, because the cell-to-cell contact is more in plate mating. When P. fluorescens was incubated in seawater, the organism progressively lost its colony forming activity within 15 days. Microscopic examination revealed the presence of very short rods, indicating that the cells have become viable but nonculturable (VNC). Mating conducted in natural seawater without any added nutrients revealed that the conjugal transfer is influenced by the physical state of the donor and the recipients as well as the availability of nutrients. But a plasmid transfer frequency of 10(-7) was obtained even after the donor cells have become VNC suggesting that the nonculturable state and nutrient deprived condition may not limit plasmid transfer. The results suggest that the terrestrial bacteria entering into the seawaters with antibiotic resistance plasmids may be responsible for the prevalence of resistance genes in the marine environment.

Anti-Bacterial Agents↗
PubMed1998

Plasmid-mediated rifampicin resistance in Pseudomonas fluorescens.

Rifampicin is an antibiotic mostly used to treat tuberculosis and leprosy, and, occasionally, other diseases. Resistance is due to alterations in membrane permeability or to mutation in the rpoB gene coding for mRNA polymerase. Both these mechanisms originate via chromosomal mutation. However, a rifampicin-resistant Pseudomonas fluorescens strain harboured a multiresistance plasmid which transferred rifampicin resistance when transformed into P. putida or Escherichia coli. Rifampicin readily diffused into the sensitive cells of the E. coli and P. putida recipients, but the transformants with the plasmid, pSCL were resistant to the drug and did not accumulate it. Potassium cyanide restored the diffusion of rifampicin into the resistant cells, indicating that an efflux pump was involved in the resistance mechanism. The resistance of the transformants and the wild strain was also abolished in sphaeroplasts generated by EDTA lysozyme treatment. Analysis of membrane proteins by SDS-PAGE revealed the presence of two new proteins in the plasmid-containing cells of E. coli, P. putida and P. fluorescens and not in the plasmid-free cells. These may be involved in the efflux of rifampicin.

Bacterial Outer Membrane Proteins↗
PubMed1998

Maintenance of a Pseudomonas fluorescens plasmid in heterologous hosts: metabolic burden as a more reliable variable to predict plasmid instability.

The stability of a large, multiresistance plasmid, pSCL of P. fluorescens CAS102 was studied in Pseudomonas putida and E. coli under various non-stress conditions. Both the strains lost the plasmid within 25 days when repeatedly subcultured in LB broth without any antibiotic. The transformants survived in sterile soil and water without any marked reduction in the viability. In sterile soil, P. putida lost 93% and E. coli, 98% of their plasmid containing population in 30 days, while in sterile water the plasmid loss was 92.5% and 97% respectively. The two variables, viz. the efficiency of plasmid-partitioning during cell division and measurement of relative specific growth rates of plasmid-plus and plasmid-minus cells which are used to predict plasmid instability cannot be used to predict plasmid loss during starvation. The utility of a third variable, viz. the metabolic burden due to plasmid maintenance in predicting plasmid instability in different hosts is discussed. The rate of plasmid loss was found to be comparatively faster in E. coli than in P. putida. The biosynthetic burden due to plasmid maintenance was also more in E. coli than in P. putida when compared to the plasmid-plus and plasmid-minus cells of the two strains which was evident from the increased nutrient uptake rates (glucose, O2, and amino acid) and increased protein content of the plasmid-plus cells of E. coli. From the results, a correlation could be found between the degree of metabolic burden and the rate of plasmid loss. The reliability of metabolic burden, to predict plasmid instability versus the relative specific growth rates is discussed.

Drug Resistance, Multiple↗
PubMed1998

Darkfield microscopic (DFM) and serologic evidences for leptospiral infection in panuveitis cases.

186 out of 226 (82%) panuveitis cases showed the presence of leptospira in their blood samples by dark field microscopy. 75% cases were found positive for leptospira after low speed centrifugation and an additional 7% became positive after high speed centrifugation. Leptospirosis was four times more common in males than in females. The disease was more prevalent in the age group of 15 to 54 years. MAT was performed in 23 cases of which 9 were positive. ELISA was performed in 20 cases of which 9 were positive. DFM was positive in 19 out of these 23 cases. MAT, ELISA and DFM were positive in six cases. Highest antibody titre was found due to L. autumalis alone in two cases, L. autumnalis, and L. pomona in one case, L. bharathy in one case, L. lanka alone in one case and L. pomona one in one case. DFM was found to be more sensitive in a smal number of cases and hence DFM needs further evaluation by other workers in this field.

Adolescent↗
PubMed1997

Usefulness of dark field microscopy after differential centrifugation in the early diagnosis of leptospirosis in dog and its human contacts.

1. We found leptospira in the blood of two out of three police dogs by dark field microscopic examination after high speed centrifugation. One dog had fever and the other was asymptomatic. Leptospira could not be seen in the urine of one police dog which died of jaundice. 11 out of 21 human contacts were found to be positive for leptospira after low speed centrifugation and 5 after high speed centrifugation. One child had jaundice and an another child had fever. Others had mild symptoms of headache to none. Dark field microscopy after differential centrifugation is useful in the early diagnosis of leptospirosis and thereby could prevent later complications like jaundice.

Adult↗
PubMed1996

Dobutamine stress testing in the cardiac catheterization laboratory.

Dobutamine stress ventriculography is a safe test that appears to separate groups of patients with and without significant coronary artery stenoses. In this study, all 7 patients with significant coronary artery stenoses who reached a heart rate > or = 110 beats/min had a positive stress test, whereas 9 of 10 control patients had a negative stress test.

Adult↗
PubMed1996

An oligodeoxyribonucleotide N3'--> P5' phosphoramidate duplex forms an A-type helix in solution.

The solution conformations of the dinucleotide d(TT) and the modified duplex d(CGCGAATTCGCG)2 with N3'--> P5' phosphoramidate internucleoside linkages have been studied using circular dichroism (CD) and NMR spectroscopy. The CD spectra indicate that the duplex conformation is similar to that of isosequential phosphodiester RNA, a A-type helix, and is different from that of DNA, a B-type helix, NMR studies of model dimers d(TpT) and N3'--> P5' phosphoramidate d(TnpT) show that the sugar ring conformation changes from predominantly C2'-endo to C3'-endo when the 3'-phosphoester is replaced by a phosphoramidate group. Two-dimensional NMR (NOESY, DQF-COSY and TOCSY spectra) studies of the duplex provide additional details about the A-type duplex conformation of the oligonucleotide phosphoramidate and confirm that all furanose rings of 3'-aminonucleotides adopt predominantly N-type sugar puckering.

Base Sequence↗
PubMed1995

Studies on the incidence of leptospirosis and possible transmission of Leptospira during leptospiraemia.

During the year 1991 and in the first half year of 1992 a total of 179 cases and 288 cases respectively were tested for the presence of Leptospira by dark ground microscopy and 86 cases (48%) and 157 cases (54.5%) were found to be positive for Leptospira in their blood samples only. The disease was endemic and more prevalent in the age group of 5 to 14 years and 15 to 54 years and affected both sexes. Clinical categorisation of 169 cases in 1991 and 266 cases in the first half of the year 1992 along with the dark ground microscopy results showed that there was no strict correlation between the concentration of Leptospira in the blood and the severity of infection. Epidemiological data regarding the occupation and the contacts indicated that students and medical staff accounted for more than fifty percent of leptospiral infection and there was the possibility of transmission of Leptospira during leptospiraemia. Dark ground microscopy studies on blood samples from 20 cases who came for repeat testing showed the presence of Leptospira in blood up to 43 days and suggested that the convalescent carrier may have a role in the transmission of Leptospira during Leptospiraemia.

Adolescent↗
PubMed1994

Hairpin formation within the human enkephalin enhancer region. 2. Structural studies.

Receptor-mediated induction of the human proenkephalin gene has been mapped to an imperfect palindrome located between -104 and -86, upstream of the transcriptional start site. Several lines of evidence suggest that receptor-mediated transcription of proenkephalin involves a reversible conformational change from duplex to a hairpin state of the enhancer [McMurray, C.T., Wilson, W.D., & Douglass, J.O. (1991) Proc. Natl. Acad. Sci. U.S.A. 88, 666]. To determine the structure that would form if such a conformational change took place, we have synthesized two 23-bp oligonucleotides, d(GCTGGCGTAGGGCCTGCGTCAGC) and d(GCTGACGCAGGCCCTACGCCAGC), whose sequences are identical to the top and the bottom strands of the native enhancer. We have found that each oligonucleotide strand exists primarily as a hairpin structure over a wide range of oligonucleotide concentrations and a wide range of temperatures (0-45 degrees C). The assignment of each imino proton was carried out using 1D and 2D nuclear Overhauser effects (NOE) and by comparison with the spectra of hairpins containing single base substitutions. The hairpin structure for each oligonucleotide contains a 3-member loop, a 10-bp stem, and two mismatched pairs. The hairpin that forms from the top strand of the enhancer and contains two GT mispaired bases creates an alternative binding site for the cyclic adenosine monophosphate element binding protein (CREB), a transcription factor that binds to and regulates the human proenkephalin gene. Circular dichroism and 31P NMR indicate that, despite the presence of mismatched pairs, each oligonucleotide hairpin adopts a B-form conformation with no unusual bending or kinking. The structure of the hairpin may explain the effect on expression of point mutations within the enhancer.

Base Sequence↗
PubMed1994

Relationship between active protection in vaccinated buffaloes against haemorrhagic septicaemia and passive mouse protection test or serum antibody titres.

The relationship between the standard passive mouse protection test or serum antibody titres measured by indirect haemagglutination or enzyme-linked immunosorbent assays and active protection in buffaloes immunized with different types of haemorrhagic septicaemia bacterins was investigated. Groups of 2-3 buffaloes were immunized with the bacterins currently in use in Asia, viz., broth bacterin (BB), alum precipitated vaccine (APV) and oil adjuvant vaccine (OAV) either subcutaneously (BB, APV) or intramuscularly (OAV) and challenged subcutaneously with virulent organisms at different periods post-immunization. Although the passive mouse protection and indirect haemagglutination tests carried out with the pre-challenge sera from vaccinated buffaloes revealed no relationship with active protection in buffaloes, a relationship was observed between the ELISA antibody titres and protection. In contrast, a dose-response relationship was observed between the homologous active and passive mouse protection test.

Animals↗
PubMed1994

Characterization of immune response and duration of protection in buffaloes immunized with haemorrhagic septicaemia vaccines.

Two of the three buffaloes immunized with a non-adjuvanted broth bacterin were found to be protected against experimental challenge at 6 weeks but not at 3 months post-challenge. Similarly all buffaloes (4/4) immunized with alum-precipitated vaccine were protected at 6 months but only 1 of the 2 vaccinated animals were protected at 12 months post-immunization. On the other hand, buffaloes immunized with an oil adjuvant and a double emulsion vaccine were completely protected at 12 months post-immunization. Statistically significant differences between immunized versus non-immune animals became evident at 3 months post-immunization, although analysis of cumulative antibody titres of pre-challenge sera of vaccinated buffaloes surviving versus those succumbing to experimental challenge revealed significant by higher antibody titres in the former as compared to the latter group. These results suggested that there was a relationship between ELISA antibody titres and active protection in buffaloes. There also appeared to be a relationship between cutaneous delayed-type hypersensitivity and active protection in buffaloes. Preliminary analysis of the antibody isotype distribution in the pre-challenge sera of 2 buffaloes vaccinated with the oil adjuvant vaccine revealed predominance of IgG1 and IgG2 subclasses whose role in protection against haemorrhagic septicaemia was not eludicated.

Animals↗
PubMed1994

Oligomannosides initiate cell spreading of laminin-adherent murine melanoma cells.

Murine melanoma cells readily bind and spread on murine laminin. Uncoupling of spreading from adhesion occurs when unglycosylated laminin is used as the cellular substratum; spreading is restored by soluble glycosylated laminin or soluble glycopeptides of laminin. In this study, using kifunensine, we produced and characterized an oligomannoside-rich glycoform of laminin. When used as a substratum for cell attachment and spreading, this laminin was as effective as mature glycosylated laminin. When added in solution to unglycosylated laminin-adherent cells, kifunensine-laminin was more effective in promoting cell spreading than mature glycosylated laminin. Reconstitution with soluble polysaccharides showed that cell spreading was initiated rapidly by microgram amounts of mannan but not other polysaccharides and approached a maximum within 1 h; titration with mannan yielded an adsorption isotherm profile. Mannose was an antagonist, preventing mannan from restoring cell spreading, but it was not an agonist. A Pronase digest of mature glycosylated laminin, depleted of its oligomannoside-peptides, was unable to restore cell spreading, whereas a control digest was fully active. Melanoma cells were unable to bind to three different neoglycoprotein surfaces, but when soluble unglycosylated laminin was present in the medium the cells adhered to and spread only upon mannosylated bovine serum albumin. Of the various cell lines known to interact with glycosylated laminin only murine melanoma cells showed oligomannoside-dependent spreading on an unglycosylated laminin substratum. The composite results indicate that oligomannosides are necessary to initiate murine melanoma cell spreading on laminin but are not sufficient for cell adhesion.

Alkaloids↗
PubMed1994

Characterization of oligomannoside binding to the surface of murine melanoma cells. Potential relationship to oligomannoside-initiated cell spreading.

The spreading of murine melanoma cells on unglycosylated laminin is initiated by soluble glycosylated laminins containing oligomannosides, or by mannan, and is inhibited by mannose (Chandrasekaran, S., Tanzer, M. L., and Giniger, M. S. (1994) J. Biol. Chem. 269, 3356-3366). In the present study, melanoma cell recognition of oligomannosides was explored by several different methods. Comparison of cell spreading, initiated by related branched oligomannosides, showed that micromolar concentrations of Man6 and Man9 were able to restore cell spreading maximally, whereas Man3 was ineffective. Man9 bound to the melanoma cells in a bimodal manner at micromolar concentrations, reaching saturation, whereas Man3 showed linear binding in the same and higher ranges. Comparison of Man9 binding with Man9-initiated cell spreading demonstrated that maximal spreading occurred at approximately half-saturation. Competition experiments showed that mannose or mannan effectively impaired Man9 binding to the cells, whereas galactose or fucose was ineffective. Mannan-conjugated fluorescent beads bound in a diffuse pattern to the surface of melanoma cells, whereas underivatized beads did not bind. The distribution of laminin-binding beta 1 integrin on the cell surface was compared with surface mannan binding. The beta 1 integrin staining pattern did not match the mannan staining pattern either in attached, nonspread cells or in attached, spread cells. The composite results support a model in which occupancy of both an integrin and a cell surface lectin is required for murine melanoma cells to spread on glycosylated laminin.

Animals↗