PubMed Health⌕ Search

Biomedical subjects

S Husain

Publications and source records attributed to S Husain.

At least 37 records · Page 2Linked to original sources
PubMed2000

Insertion-deletion polymorphism of the ACE gene modulates reversibility of endothelial dysfunction with ACE inhibition.

BACKGROUND: The aim of this study was to examine whether angiotensin-converting enzyme (ACE) inhibition improves coronary endothelial dysfunction in patients with atherosclerosis and its risk factors and whether this was related to the ACE insertion-deletion (I/D) polymorphism. METHODS AND RESULTS: In 56 patients with atherosclerosis or its risk factors, we studied endothelium-dependent responses with acetylcholine and endothelium-independent function with sodium nitroprusside, before and after ACE inhibition with enalaprilat. Enalaprilat did not alter either resting coronary tone or vasodilation with sodium nitroprusside. However, it potentiated the coronary microvascular and epicardial responses with acetylcholine; coronary blood flow increased from 82+/-7 to 90+/-8 mL/min (P=0.05) after enalaprilat. Patients with depressed endothelial function (P<0.001) and those with ACE DD or ID genotypes (P=0.002) but not those homozygous for the I allele had the greatest improvement by multivariate analysis. Similarly, acetylcholine-mediated epicardial vasomotion improved in segments that initially constricted (endothelial dysfunction): from -10.1+/-1% to -1.4+/-2% (P<0.001) after enalaprilat. No augmentation was observed in segments that dilated (normal endothelial dysfunction) with acetylcholine. Patients with the D allele, hypercholesterolemia, and smokers (all P<0.05) had greater improvement. CONCLUSIONS: Acute ACE inhibition improves coronary epicardial and microvascular endothelium-dependent vasomotion in patients with atherosclerosis or its risk factors who have endothelial dysfunction and presence of the D allele.

Acetylcholine↗
PubMed2000

Infections of the central nervous system in transplant recipients.

Central nervous system (CNS) infections, accounting for 4-29% of CNS lesions in transplant recipients, are a significant post-transplant complication. Focal CNS infectious lesions or brain abscesses have been documented in 0.36-1% of the transplant recipients. Mycelial fungi, particularly Aspergillus, are by far the most frequent etiologies of post-transplant brain abscesses. Bacteria, with the exception of Nocardia, are rarely associated with brain abscesses in transplant recipients. Time of onset and concurrent extraneural lesions have implications relevant towards invasive diagnostic procedures in transplant recipients with brain abscesses. Meningoencephalitis in transplant recipients is predominantly due to viruses, e.g., herpesviruses, and less frequently due to Listeria monocytogenes, Toxoplasma gondii, and Cryptococcus. Despite a wide, and at times perplexing array of opportunistic pathogens that can cause CNS infections, the temporal association of the infection with the time elapsed since transplantation, risk factors, clinical manifestations, and neuroimaging characteristics of the lesion can allow a reasoned and rational approach towards the recognition, diagnosis, and appropriate management of CNS infections in transplant recipients.

Brain Abscess↗
PubMed2000

Characterization of a subcloned fragment (pBA0.6) of pCMM86 located on 17q21 and its potential use in generating an individual-specific DNA profile.

Sequence analysis was carried out of a human clone pBA0.6 generated after exonuclease III/S1 nuclease digestion and subcloning of pCMM86 (GDB: 168382, D17S74), which was not available in the database. It revealed the presence of a reiterating core motif of 24mer GTGGGTGTGTTGGAGGGGGTGAGG, present 23 times, which was GC-rich and minisatellitic in nature. Genomic blots of HaeIII-digested human DNA, when hybridized with pBA0.6, generated a ladder of bands between 29.0 kb and 2.1 kb. Hybridization analyses of 88 unrelated individuals belonging to four regions of India using this probe revealed polymorphic bands which were individual specific. The probability of identity ranged from 5.07x10(-14) in Punjabis to 2.64x10(-16) in Bengalis and was found to be 3.06x10(-16) in UPites, whereas in the case of South Indians, it was 3.9x10(-15). Three sets of isomorphic bands at 29.0 kb, 2.4 kb, and 2.1 kb were common between the individuals of all the regions and served as internal markers. The 29.0-kb band was observed to be Homo sapiens specific. Construction of dendrograms based on the UPGMA method with Jaccard's coefficient values suggested less genetic similarity/high genetic diversity in all the population groups, indicating that the samples taken were random. Maximum likelihood estimates through the bootstrap sampling method showed that Punjabis, Bengalis, and UPites formed one cluster, whereas South Indians formed a separate cluster, altogether thus showing the proximity of these three population groups compared with that from South India. A preliminary study by Northern hybridization with pBA0.6 resulted in two transcripts of 0.63 kb and 0.29 kb. This finding was corroborated with RT-PCR results where 2 amplicons, matching the expected size of two open reading frames within the minisatellite sequence, were obtained. The role of the two transcripts from the minisatellite sequence is not clear as yet, and it is probable that these messages may not get translated because of the absence of a eukaryotic Kozak sequence around the initiator methionine in the pBA0.6 sequence.

Base Sequence↗
PubMed2000

Role of protein kinase C alpha and mitogen-activated protein kinases in endothelin-1-stimulation of cytosolic phospholipase A2 in iris sphincter smooth muscle.

We have investigated the roles of protein kinase C (PKC) and mitogen-activated protein kinases (MAPK) in the phosphorylation and activation of cytosolic phospholipase A2 (cPLA2) in endothelin-1- (ET-1) stimulated cat iris sphincter smooth muscle (CISM) cells. We found that in these cells both PKC and p38 MAP kinases play a critical role in ET-1-induced cPLA, phosphorylation and arachidonic acid (AA) release. Our findings indicate that stimulation of the endothelin-A- (ET(A)) receptor leads to: (1) activation of Gq protein which stimulates phospholipase C to hydrolyze the polyphosphoinositide PIP, into diacylglycerol (DAG) and inositol trisphosphate (IP3), the DAG may then activate PKC to phosphorylate and activate cPLA2; and (2) activation of Gi protein, which, through a series of kinases, leads to the stimulation of p38 MAPK and subsequently to phosphorylation and activation of cPLA2. The ability of the activated ET(A)-receptor, which is coupled to both Gq and Gi proteins, to recruit and activate this complex signal transduction mechanism remains to be clarified.

Animals↗
PubMed1999

Separation, identification and determination of sanguinarine in argemone and other adulterated edible oils by reversed-phase high-performance liquid chromatography.

A simple, rapid and reliable reversed-phase high-performance liquid chromatographic method for the separation and determination of sanguinarine in argemone and other edible oils has been developed. The separation has been achieved on a C18 column with CH3OH-CH3CN-tetrahydrofuran-water as mobile phase using diode array detection at 280 nm. The minimum detection limit of sanguinarine in the adulterated edible oils is 5 microg/g.

Alkaloids↗
PubMed1999

Gas chromatographic-mass spectrometric separation, identification and determination of C6-C12 cyclic imides in thermally treated epoxy and alkyd resins to locate hot spots inside large electricity generators.

A simple and rapid GC-MS method for separation, identification and quantitative determination of long-chain cyclic imides in the 300 degrees C thermally treated epoxy and alkyd resins has been developed. The method provides a positive means of identifying C6-C12 cyclic imide derivatives by GC-MS and enables the specific area of overheating to be identified, thereby averting catastrophic failures of power generators in service.

Cyclization↗
PubMed1999

Endothelin-1 activates p38 mitogen-activated protein kinase and cytosolic phospholipase A2 in cat iris sphincter smooth muscle cells.

We have shown previously that cytosolic phospholipase A(2) (cPLA(2)) is responsible for endothelin-1-induced release of arachidonic acid for prostaglandin synthesis in cat iris sphincter smooth muscle (CISM) cells [Husain and Abdel-Latif (1998) Biochim. Biophys. Acta 1392, 127-144]. Here we show that p38 mitogen-activated protein (MAP) kinase, but not p42/p44 MAP kinases, plays an important role in the phosphorylation and activation of cPLA(2) in endothelin-1-stimulated CISM cells. This conclusion is supported by the following findings. Both p38 MAP kinase and p42/p44 MAP kinases were present in the CISM cells and both were activated by endothelin-1. SB203580, a potent specific inhibitor of p38 MAP kinase, but not the p42/p44 MAP kinases specific inhibitor, PD98059, markedly suppressed endothelin-1-enhanced cPLA(2) phosphorylation, cPLA(2) activity and arachidonic acid release. The addition of endothelin-1 resulted in the phosphorylation and activation of cPLA(2). Endothelin-1 stimulated p38 MAP kinase activity in a time- and concentration-dependent manner, and these effects were mediated through the endothelin-A receptor subtype. The protein kinase C (PKC) inhibitor, RO 31-8220, had no inhibitory effect on endothelin-1-induced p38 MAP kinase activation, suggesting that endothelin-1 activation of p38 MAP kinase is independent of PKC. Pertussis toxin inhibited both endothelin-1 and mastoparan stimulation of p38 MAP kinase activity and arachidonic acid release. The inhibitory effects of pertussis toxin are not mediated through cAMP formation. Mastoparan-stimulated [(3)H]arachidonic acid release and cPLA(2) activation was inhibited by SB203580, but not by RO 31-8220. These data suggest that endothelin-1 binds to the endothelin-A receptor to activate the Gi-protein which, through a series of kinases, leads to the activation of p38 MAP kinase and subsequently to phosphorylation and activation of cPLA(2). Activation of cPLA(2) leads to the liberation of arachidonic acid from membrane phospholipids. The ability of the activated endothelin-A receptor, which is coupled to both Gq- and Gi-proteins, to recruit and activate this complex signal transduction pathway remains to be elucidated. Further studies on the mechanism of these relationships could provide important information about the functions of p38 MAP kinase in smooth muscle.

Animals↗
PubMed1999

Effect of enalaprilat on nitric oxide activity in coronary artery disease.

Atherosclerosis is associated with vascular endothelial dysfunction and reduced nitric oxide (NO) activity. Enhancement of NO activity may have an antiatherogenic action. This study was performed to determine whether angiotensin-converting enzyme (ACE) inhibition improves peripheral vascular NO activity in patients with atherosclerosis. In the femoral circulation of 43 patients with atherosclerosis and 10 controls, we studied endothelium-dependent vasodilation with bradykinin and acetylcholine, and endothelium-independent vasodilation with sodium nitroprusside before and after enalaprilat. In 22 patients, we repeated these infusions in the presence of L-N(G) monomethyl arginine (L-NMMA). Doppler-femoral artery flow velocity was measured. Before ACE inhibition, acetylcholine responses were depressed in patients with atherosclerosis compared with controls (p = 0.03). Enalaprilat did not alter femoral vascular tone at rest or vasodilation with sodium nitroprusside, but potentiated bradykinin-mediated vasodilation in patients (p<0.001) and controls (p = 0.02). Acetylcholine-mediated vasodilation was augmented only in patients (p<0.001), but not in control subjects. L-NMMA inhibited the potentiation by enalaprilat of acetylcholine and bradykinin responses. This study demonstrates that ACE inhibition selectively improves endothelial dysfunction in human atherosclerosis by enhancing NO activity. The antithrombotic and antiproliferative effects of NO may reduce adverse manifestations related to atherosclerosis during long-term therapy.

Angiotensin-Converting Enzyme Inhibitors↗
PubMed1999

Primary pericardial synovial sarcoma: a case report and literature review.

Primary synovial sarcoma of the heart is a rare tumor, with only six previous cases having been reported in the literature. Treatment has included surgery with or without chemotherapy. We present the first case of a documented synovial sarcoma arising from the pericardium in a 19-year-old man. Molecular analysis for t(X; 18) SYT-SSX gene fusion was positive. Radiation treatment was given postoperatively to the entire heart with a boost to the area where the margins were positive.

Adult↗
PubMed1999

Performance and potential impact of a chest pain prediction rule in a large public hospital.

PURPOSE: To evaluate the performance of a previously validated prediction rule for patients presenting to the emergency department with chest pain and the potential impact of the rule on triage decisions. SUBJECTS AND METHODS: In a prospective cohort study, physician investigators interviewed consecutive patients admitted for suspected acute ischemic heart disease (n = 207) by emergency department attending physicians who had not used the prediction rule. We measured the accuracy of the rule in predicting cardiac complications in these patients, and compared actual triage decisions with those that might have been recommended by use of the prediction rule. We also measured comorbid illnesses among patients stratified as very low risk by the prediction rule, as well as the effect of standardizing the definition of unstable angina and interpretation of electrocardiograms (ECG) on the rule's sensitivity and specificity. RESULTS: Overall, the rate of major cardiac complications (4.3%) was similar to that reported in the original study (3.6%). The prediction rule performed well in predicting these complications in our patients (area under receiver operating characteristic curve 0.84 versus 0.80 in the original study; difference 0.04, 95% confidence interval [CI] -0.07, 0.14). Standardized definitions of unstable angina and interpretation of ECGs improved the specificity of the prediction rule in predicting complications (55% versus 47%; difference 8%, 95% CI 1.5%, 13.7%). The prediction rule recommended admission to telemetry units in 65 fewer patients than actually occurred (31% of the entire cohort). None of these patients had major complications. A substantial minority of "very low risk" patients (27%) had comorbid illnesses requiring inpatient treatment. CONCLUSIONS: This independent validation of the prediction rule suggests that it can improve triage decisions for patients admitted with suspected acute ischemic heart disease. Additional studies are needed to test prospectively the performance of the prediction rule in actual decision making, its acceptance by clinicians, and its cost effectiveness.

Adult↗
PubMed1999

Abnormal flow-mediated epicardial vasomotion in human coronary arteries is improved by angiotensin-converting enzyme inhibition: a potential role of bradykinin.

OBJECTIVES: This study was performed to determine whether angiotensin converting enzyme (ACE) inhibition improves endothelium-dependent flow-mediated vasodilation in patients with atherosclerosis or its risk factors and whether this is mediated by enhanced bradykinin activity. BACKGROUND: Abnormal coronary vasomotion due to endothelial dysfunction contributes to myocardial ischemia in patients with atherosclerosis, and its reversal may have an antiischemic action. Previous studies have shown that ACE inhibition improves coronary endothelial responses to acetylcholine, but whether this is accompanied by improved responses to shear stress remains unknown. METHODS: In 19 patients with mild atherosclerosis, metabolic vasodilation was assessed during cardiac pacing. Pacing was repeated during separate intracoronary infusions of low-dose bradykinin (BK) and enalaprilat. Endothelium-dependent and -independent vasodilation was estimated with intracoronary BK and sodium nitroprusside respectively. RESULTS: Enalaprilat did not alter either resting coronary vascular tone or dilation with sodium nitroprusside, but potentiated BK-mediated dilation. Epicardial segments that constricted abnormally with pacing (-5+/-1%) dilated (3+/-2%) with pacing in the presence of enalaprilat (p = 0.002). Similarly, BK at a concentration (62.5 ng/min) that did not alter resting diameter in the constricting segments also improved the abnormal response to a 6+/-1% dilation (p < 0.001). Cardiac pacing-induced reduction in coronary vascular resistance of 27+/-4% (p < 0.001) remained unchanged after enalaprilat. CONCLUSIONS: Thus ACE inhibition: A) selectively improved endothelium-dependent but not-independent dilation, and B) abolished abnormal flow-mediated epicardial vasomotion in patients with endothelial dysfunction, in part, by increasing endogenous BK activity.

Adenosine↗
PubMed1999

Conformations of hydrophobic peptides in trifluoroethanol, water and in solid state: a circular dichroism and Fourier Transform Infrared study.

The conformations of peptides corresponding to KLLIALVLCFLPLAALG have been examined in trifluoroethanol (TFE), aqueous medium by circular dichroism spectroscopy and in the solid state by Fourier Transform Infra Red Spectroscopy (FTIR). The 17-residue parent peptide and peptides corresponding to shorter segments LVLCFLPLAALG and CFLPLAALG showed preference for helical conformation in TFE. Even the shorter hydrophobic peptides corresponding to KLLIA and LVL showed propensity for beta-turn conformations in TFE. However, peptides corresponding to the relatively polar segment FLPLAALG were unordered in TFE. In water, peptides that showed ordered conformation in TFE preferred beta-conformation. In solid-state, FTIR spectra indicated that the hydrophobic peptides adopt beta-structures with extensive hydrogen bonded network in the solid-state. The hydrophobic core segment thus appears to dictate the conformational propensity of the peptide.

Amino Acid Sequence↗
PubMed1998

Targeted cleavage of HIV-1 envelope gene by a DNA enzyme and inhibition of HIV-1 envelope-CD4 mediated cell fusion.

With the ultimate aim of developing an effective antiviral strategy against HIV-1, a mono-DNA enzyme possessing the 10-23 catalytic motif [Santoro and Joyce (1997) Proc. Natl. Acad. Sci. USA 94, 4264-4266] was synthesized against the HIV-1 envelope gene. We tested the in vitro cleavage efficiency of the 178 bp long truncated HIV-1 Env transcript by DNA enzyme 6339. Protein independent and Mg2+ dependent specific cleavage products were obtained. As soon as 5 min after mixing equimolar concentrations of DNA enzyme and substrate RNA, more than 50% cleavage was observed which increased steadily over a period of 4 h. Very little cleavage was obtained at 1 mM MgCl2 concentration which improved significantly when the concentration of MgCl2 was increased up to 20 mM. Specific inhibition of cell membrane fusion caused by the interaction of gp160 and CD4 in HeLa cells was observed when the above DNA enzyme was used. Thus, these chemically synthesized DNA enzymes could prove to be very useful for in vivo application.

Base Sequence↗
PubMed1998

Role of protein kinase C alpha in endothelin-1 stimulation of cytosolic phospholipase A2 and arachidonic acid release in cultured cat iris sphincter smooth muscle cells.

We have investigated the role and mechanism of protein kinase C (PKC) isoforms in endothelin-1 (ET-1)-induced arachidonic acid (AA) release in cat iris sphincter smooth muscle (CISM) cells. ET-1 increased AA release in a concentration (EC50=8 nM) and time-dependent (t1/2=1.2 min) manner. Cytosolic phospholipase A2 (cPLA2), but not phospholipase C (PLC), is involved in the liberation of AA in the stimulated cells. This conclusion is supported by the findings that ET-1-induced AA release is inhibited by AACOCF3, quinacrine and manoalide, PLA2 inhibitors, but not by U-73122, a PLC inhibitor, or by RHC-80267, a diacylglycerol lipase inhibitor. A role for PKC in ET-1-induced AA release is supported by the findings that the phorbol ester, PDBu, increased AA release by 96%, that prolonged treatment of the cells with PDBu resulted in the selective down regulation of PKCalpha and the complete inhibition of ET-1-induced AA release, and that pretreatment of the cells with staurosporine or RO 31-8220, PKC inhibitors, blocked the ET-1-induced AA release. Gö-6976, a compound that inhibits PKCalpha and beta specifically, blocked ET-1-induced AA release in a concentration-dependent manner with an IC50 value of 8 nM. Thymeatoxin (0.1 microM), a specific activator of PKCalpha, beta, and gamma induced a 150% increase in AA release. Treatment of the cells with ET-1 caused significant translocation of PKCalpha, but not PKCbeta, from cytosol to the particulate fraction. These results suggest that PKCalpha plays a critical role in ET-1-induced AA release in these cells. Immunochemical analysis revealed the presence of cPLA2, p42mapk and p44mapk in the CISM cells. The data presented are consistent with a role for PKCalpha, but not for p42/p44 mitogen-activated protein kinase (MAPK), in cPLA2 activation and AA release in ET-1-stimulated CISM cells since: (i) the PKC inhibitor, RO 31-8220, inhibited ET-1-induced AA release, cPLA2 phosphorylation and cPLA2 activity, but had no inhibitory effect on p42/p44 MAPK activation, (ii) genistein, a tyrosine kinase inhibitor, inhibited ET-1-stimulated MAPK activity but had no inhibitory effect on AA release in the ET-1-stimulated cells. We conclude that in CISM cells, ET-1 activates PKCalpha, which activates cPLA2, which liberates AA for prostaglandin synthesis.

Animals↗
PubMed1998

Aspirin improves endothelial dysfunction in atherosclerosis.

BACKGROUND: The beneficial effects of aspirin in atherosclerosis are generally attributed to its antiplatelet activities, but its influence on endothelial function remains uncertain. We hypothesized that a cyclooxygenase-dependent constricting factor contributes to the endothelial dysfunction in atherosclerosis and that its action can be reversed by aspirin. METHODS AND RESULTS: In 14 patients with coronary atherosclerosis and 5 with risk factors, we tested femoral vascular endothelial function with acetylcholine and substance P and endothelium-independent function with sodium nitroprusside before and after intravenous aspirin. Drugs were infused into the femoral artery, and Doppler flow velocity was measured. Acetylcholine-induced but not substance P-or sodium nitroprusside-induced vasodilation was lower in patients with atherosclerosis than in those with only risk factors. Aspirin had no baseline effect but improved acetylcholine-mediated vasodilation only in patients with atherosclerosis; at the peak dose, acetylcholine-mediated femoral vascular resistance index was 19 +/- 5%, P=.002 lower. There was a correlation between the baseline response to acetylcholine and the magnitude of improvement with aspirin (r=.5, P=.05). Thus, patients with a depressed response to acetylcholine had greater improvement with aspirin, and vice versa. The presence of atherosclerosis was an independent determinant of improvement with aspirin. Aspirin had no effect on the responses to either substance P or sodium nitroprusside. CONCLUSIONS: Cyclooxygenase-dependent, endothelium-derived vasoconstrictor release modulates acetylcholine-induced peripheral vasodilation in patients with atherosclerosis. Improvement of endothelial dysfunction with aspirin may improve vasodilation, reduce thrombosis, and inhibit progression of atherosclerosis and provides a pathophysiological basis for the beneficial effects of aspirin in atherosclerosis.

Acetylcholine↗
PubMed1998

DNA breakage by L-DOPA and Cu(II): breakage by melanin and bacteriophage inactivation.

We have previously shown that L-DOPA in the presence of Cu(II) caused DNA cleavage through the generation of reactive oxygen species such as the hydroxyl radical. Since L-DOPA is the precursor for the synthesis of melanin, we have studied the action of melanin on DNA in a similar reaction. In this paper, we show that melanin in the presence of Cu(II) also causes DNA strand breakage. However, the rate of such strand breakage is considerably less than l-DOPA. Melanin and L-DOPA are both capable of generating superoxide anion. Furthermore, the action of L-DOPA and Cu(II) on bacteriophage lambda reduces its viability. The results are discussed in relation to the putative role of L-DOPA-Cu(II) system as a source of endogenous generation of reactive oxygen species.

Bacteriophage lambda↗
PubMed1998

First report of a healthy Indian heterozygous for delta 32 mutant of HIV-1 co-receptor-CCR5 gene.

The beta-chemokine receptor, CCR5, is a major co-receptor for macrophage tropic non-syncytia-inducing isolates of HIV-1. Recently a 32 bp homozygous deletion in the coding region of CCR5 has been reported in a very small percentage (< 1%) of Caucasian individuals who remain uninfected, despite multiple exposure to the wild-type virus. This mutant allele in the heterozygous form (CCR5/32 ccr5) was readily detected in a normal unrelated Caucasian population of European heritage with varying frequencies (13-20%). However, when a large number of the non-Caucasian population (261 Africans and 423 Asians) were screened for the presence of this deleted allele, not a single case of either homozygous or heterozygous mutant for delta 32 allele of CCR5 was detected. We screened 100 normal individuals and found a single heterozygous case with an identical 32 bp deletion in CCR5 gene reported earlier, the rest possessed wild-type alleles. This deleted gene was inherited in Mendelian fashion among the family members of this individual. Thus, the frequency of this deleted allele in India among unrelated normal individuals is likely to be very low (< 1%). We observed a moderate transdominant effect of this mutant allele in a fusion assay. Finally, we show a significant inhibition of fusion of cell membranes when the 176-bp region of CCR5 was used as an antisense.

Alleles↗