PubMed Health⌕ Search

Biomedical subjects

S Jouannic

Publications and source records attributed to S Jouannic.

8 recordsLinked to original sources
PubMed2001

The protein kinases AtMAP3Kepsilon1 and BnMAP3Kepsilon1 are functional homologues of S. pombe cdc7p and may be involved in cell division.

We identified an Arabidopsis thaliana gene, AtMAP3Kepsilon1, and a Brassica napus cDNA, BnMAP3Kepsilon1, encoding functional protein serine/threonine kinases closely related to cdc7p and Cdc15p from Schizosaccharomyces pombe and Saccharomyces cerevisiae, respectively. This is the first report of cdc7-related genes in non-fungal eukaryotes; no such genes have as yet been identified in Metazoans. The B. napus protein is able to partially complement a cdc7 loss of function mutation in S. pombe. RT-PCR and in situ hybridisation revealed that the A. thaliana and B. napus genes are expressed in both the sporophytic and the gametophytic tissues of the respective plant species and revealed further that expression is highest in dividing cells. Moreover, AtMAP3Kepsilon1 gene expression is cell cycle-regulated, with higher expression in G2-M phases. Our results strongly suggest that the plant cdc7p-related protein kinases are involved in a signal transduction pathway similar to the SIN pathway, which positively regulates cytokinesis in S. pombe.

Amino Acid Sequence↗
PubMed1999

Plant MAP kinase kinase kinases structure, classification and evolution.

The increasing number of reports describing plant MAP kinase signalling components reflects the cardinal role that MAP kinase pathways are likely to play during plant growth and development. Relationship and structural analyses of plant MAP kinase kinase kinase related cDNAs and genes established, on one hand, the PMEKKs, which may be distinguished into the alpha, beta, gamma, and zeta groups, and, on the other hand, the PRAFs that consist of the delta, eta and theta groups. Plant MAP3Ks are characterized by different primary structures, but conserved within a single group. A relationship analysis, which included animal, fungal and plant MAP3Ks, revealed a high degree of diversity among this biochemically established set of proteins, thus suggesting a range of biological functions. Four major families emerged, namely the MEKK/STE11, including the PMEKKs, the RAF, including the PRAFs, as well as the MLK and CDC7 families. These four families showed phylum-dependent distributions. Signature sequences characterizing the RAF family and the RAF subfamilies have been evidenced. However, no equivalent sequence motifs were identified for the MEKK/STE11 family, which is highly heterogeneous.

Evolution, Molecular↗
PubMed1999

Identification of cdc2cAt: a new cyclin-dependent kinase expressed in Arabidopsis thaliana flowers.

In the present paper, the isolation of a third cyclin-dependent kinase gene and its cognate cDNA from Arabidopsis thaliana is described. Whereas other characterised cdc2 genes are ubiquitously expressed in Arabidopsis, expression of cdc2cAt is restricted to flowers. This gene, named cdc2cAt, differs from the two previously reported cdc2 genes in its organisation. Comparison with other cdc2 genes suggests that the deduced protein belongs to a new family of CDC2-like proteins related to the human CHED protein kinase.

Amino Acid Sequence↗
PubMed1999

Characterisation of novel plant genes encoding MEKK/STE11 and RAF-related protein kinases.

Various elements of the MAP kinase module have been isolated in plants. We describe here the characterisation of 14 new plant cDNAs and genes encoding putative MAP kinase kinase kinases (MAP3Ks) related to the MEKK/STE11 and RAF protein kinases. Plant MAP3Ks are characterised by a variety of primary structures conserved within closely related proteins. Southern blot analysis suggests that plant MAP3Ks are heterogenous in their genomic structure, existing either as single copy genes or as small gene families. An RT-PCR analysis showed that in Arabidopsis thaliana, all organs studied contain detectable levels of transcripts of each of the MAP3K genes identified; however, signals obtained with mature pollen were weak or non-existent except for AtMAP3Kgamma. None of the reported genes share a cell-cycle or a cold stress regulated expression.

Amino Acid Sequence↗
PubMed1999

Molecular characterisation of plant cDNAs BnMAP4Kalpha1 and BnMAP4Kalpha2 belonging to the GCK/SPS1 subfamily of MAP kinase kinase kinase kinase.

Several yeast and mammal MAP kinase modules require, upstream of their MAP kinase kinase kinase (MAP3K), a MAP3K kinase (MAP4K). An Arabidopsis thaliana EST clone, sharing identity to MAP4Ks from yeast and mammals, has been used to isolate cDNA clones from a Brassica napus microspore-derived embryo cDNA library. The BnMAP4Kalpha1 and BnMAP4K-alpha2 clones encode putative proteins possessing the 12 subdomains of the serine/threonine protein kinase catalytic domain. A detailed analysis showed that they belong to the GCK/SPS1 subfamily of MAP4K proteins which possess an amino terminal catalytic domain and a long carboxy terminal tail. A Southern blot analysis suggested that the two proteins are encoded by a small multigene family. Expression studies revealed the presence of BnMAP4Kalpha1 and -alpha2 transcripts in all the tissues examined; however, they are most abundant in roots, siliques and flower buds. The expression of BnMAP4Kalpha1 and -alpha2 at the three main developmental stages of microspore-derived embryos (i.e., globular/heart, torpedo and cotyledonary) was confirmed by northern blot and RT-PCR analysis. An expression analysis of the above genes using synchronised Arabidopsis thaliana cell suspensions showed that the homologues genes are cell cycle regulated.

Amino Acid Sequence↗
PubMed1993

Secondary structure and phylogeny of the chloroplast 23S rRNA gene from the brown alga Pylaiella littoralis.

The entire nucleotide sequence of a 23S rRNA gene from the brown alga Pylaiella littoralis (L.) Kjellm has been determined. The predicted length of the 23S rRNA is 2948 nucleotides, including the 4.5S rRNA-like region at the 3' end of the molecule. The putative transcript has been folded into a secondary structure by comparison to existing structure models, and the predicted helical regions were inspected by identifying compensatory downstream base changes. The 23S rRNA secondary structure presented here has features that are unique to P. littoralis (no other chromophyte or red algal 23S rRNA sequences are yet available), but has none of the features specific to the chloroplast rRNAs of green plants and green algae. The Pylaiella sequence was aligned with analogous plastidial and eubacterial gene sequences, and the alignment was used to construct a phylogenetic tree. The plastidial sequences formed a coherent cluster closely associated with the 23S rRNA of the cyanobacterium Anacystis nidulans. Within the plastid group, the P. littoralis sequence was most closely related to that of Euglena gracilis confirming earlier analyses based upon 16S rRNA sequences.

Base Sequence↗
PubMed1992

Sequence, proposed secondary structure, and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm.

The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTTGGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.

Amino Acid Sequence↗