PubMed Health⌕ Search

Biomedical subjects

S Knapp

Publications and source records attributed to S Knapp.

At least 109 records · Page 6Linked to original sources

[Therapy of high-grade non-Hodgkin's lymphoma].

Complete remission can be achieved in 50 to 80% of adult patients with high-grade non-Hodgkin's lymphoma [2, 33]. The average disease-free survival is 40 to 50% at 3 years and 30 to 35% at 5 years [2, 6]. The diagnosis of non-Hodgkin's lymphoma should still be based on the histopathological and immunohistochemical evaluation of a surgical biopsy specimen. Initial staging involves radiological evaluation of tumor mass and lymph-node involvement, bone marrow biopsy, conventional laboratory investigations including LDH and beta 2-microglobulin, as well as chromosome analysis and molecular biology. These methods are also used for monitoring of patients during and after therapy. Established negative risk factors include age over 60 years, clinical stage III or IV, involvement of more than 1 extranodal site, a WHO performance status of 2 or more, and an elevation of the LDH. CHOP remains the standard chemotherapy. Aggressive regimens of the second and third generations, as well as dose-intensification have failed to prove a superior effect on overall survival [7]. Full-dose treatment on schedule can be facilitated by supportive therapy with cytokines such as G-CSF or GM-CSG. High-risk patients may have a favorable outcome after myeloablative chemotherapy and radiation followed by autologous or allogeneic bone marrow transplantation. Co-ordinated planning between conventional centers and transplant units should lead to a risk adjusted treatment of the individual patient.

Antineoplastic Combined Chemotherapy Protocols↗

Guanine-rich (GGNNGG) elements at chromosomal breakpoints interact with a loop-forming, single-stranded DNA-binding protein.

Proto-oncogene-activation is frequently preceded by chromosomal translocations. Several models suggest that DNA single-strands and loops may serve as intermediates in the process of illegitimate recombination. Guanine-rich, repetitive elements are preferred sites of chromosomal exchange and can undergo conformational changes which result in the generation of single-stranded DNA. Here we describe a single-stranded DNA-binding protein which binds specifically to guanine-rich elements at the breakpoints of human reciprocal translocations, including the t(14;18), t(2;8), t(9;22), t(15;17) and t(4;11) in leukemia and lymphoma. The primitive binding consensus consists of two guanine-residues on either side separated by a spacer of at least two nucleotides (GGN-NGG). Binding activity is unaltered by a spacer length of up to 46 nucleotides. These data suggest that the protein has the unique ability to form or stabilize DNA-loops and may thus play a general role in recombination.

Base Sequence↗

Mechanism of the chromosomal translocation t(14;18) in lymphoma: detection of a 45-Kd breakpoint binding protein.

The translocation t(14;18) between the BCL-2 oncogene and the Ig heavy chain (IgH) gene provides the molecular basis for the development of follicular lymphomas. The illegitimate recombination occurs in early B cells. While V(D)J-recombinase is most likely involved on the chromosome 14 part, little is known about the mechanism of breakage on chromosome 18. We investigated the BCL-2 breakpoint regions for their structural vulnerability and protein binding capacity. We found that the major breakpoint region (mbr) contains an S1 nuclease-sensitive site and is the target of an endogenous nuclease present in early B cells. A 45 Kd nuclear protein (bp45) from early B cell extracts binds to a homopurine-homopyrimidine stretch (GGGAGGACGGGAGGAAGGCG) in the mbr, which is homologous to a recombinatorial element in Escherichia coli (CHI). The protein also binds to homologous sequences in the minor breakpoint cluster region (mcr) and in the IgH locus. The localization of the binding sites on both chromosomes as well as the tissue distribution of bp45 suggest that this protein-DNA interaction is involved in the translocation t(14;18). The DNA binding motif is also present at other translocation breakpoints indicating a more general role for this mechanism.

B-Lymphocytes↗

Systemic Endopolyploidy in Arabidopsis thaliana.

Microfluorometric analysis of the nuclear DNA contents of the somatic tissues of Arabidopsis thaliana has revealed extensive endoreduplication, resulting in tissues that comprise mixtures of polyploid cells. Endoreduplication was found in all tissues except those of the inflorescences and was developmentally regulated according to the age of the tissues and their position within the plant.

Journal Article↗

Identification of a virulence-associated antigen of Toxoplasma gondii by use of a mouse monoclonal antibody.

A monoclonal antibody generated against the mouse-lethal RH strain of Toxoplasma gondii was developed. Tachyzoites of virulent and avirulent T. gondii isolates grown in permanent macrophage cell cultures were examined for differences in reactivity with this antibody. Virulence of these Toxoplasma isolates was quantified by injecting different numbers of tachyzoites into NMRI mice and observing the animals for signs of infection or death. The monoclonal antibody identified a 23-kDa antigen expressed by the mouse-lethal strains BK and RH, whereas this antigen was not detected in low-mouse-virulent strains, which were all clinical isolates from Europe. Using Western blot (immunoblot), immunofluorescence, and immunoelectron microscopy, we localized the 23-kDa antigen to the membrane compartment. From these results, we suggest that this 23-kDa antigen is a marker of strain virulence upon which a virulence classification of T. gondii may be based.

Animals↗

Structures of a spiro[3.3]heptane and a related dispiro[3.1.3.1]decane derivtive.

2,2,6,6-Tetrakis(mesyloxymethyl)spiro[3.3]heptane (1), C15H28O12S4, Mr = 528.64, triclinic, P1, a = 10.319 (1), b = 14.233 (2), c = 8.5187 (9) A, alpha = 97.87 (1), beta = 104.08 (1), gamma = 98.86 (1) degrees, V = 1179.0 (6) A3, Z = 2, Dm = 1.46 (1), Dx = 1.489 Mg m-3, lambda(Mo K alpha) = 0.71073 A, mu = 0.44 mm-1, F(000) = 556, T = 298 (1) K, R = 0.036 for 2411 reflections. Diethyl 8,8-bis(mesyloxymethyl)dispiro[3.1.3.1]decane-2,2-dicarboxyl ate (2) C20H32O10S2, Mr = 496.60, triclinic, P1, a = 12.168 (1), b = 16.789 (2), c = 5.9411 (6) A, alpha = 90.416 (8), beta = 94.294 (9), gamma = 87.590 (9) degrees, V = 1209.2 (4) A3, Z = 2, Dm = 1.35 (1), Dx = 1.364 Mg m-3, lambda(Mo K alpha) = 0.71073 A, mu = 0.26 mm-1, F(000) = 528, T = 292 (1) K, R = 0.037 for 2530 reflections. The cyclobutane rings in both structures are puckered. Dihedral angles of these rings in the spiroheptane derivative (1) [12.9 (7) and 21.2 (5) degrees], and in the end rings of the dispirodecane derivative (2) [18.9 (5) and -18.5 (4) degrees], are significantly smaller than that for the central cyclobutane ring in (2) [29.0 (3) degrees]. Ring puckering in (2) gives the molecule a decided bow shape when viewed normal to the best plane of the central four-membered ring.

Models, Molecular↗

Sensitive analysis of plasma physostigmine levels using dual-cell electrochemistry in the redox mode.

A column liquid chromatographic method using dual-electrode, redox electrochemical detection has been developed for measuring plasma and cerebrospinal fluid physostigmine levels. The method is suitable for detecting drug levels in a geriatric population following oral ingestion of sustained-release physostigmine preparations and for determining the pharmacokinetics of these preparations in biological fluids.

Administration, Oral↗

A new assay for invasion of HeLa 229 cells by Bordetella pertussis: effects of inhibitors, phenotypic modulation, and genetic alterations.

Invasion and intracellular survival of Bordetella pertussis in HeLa 229 cells was studied by a new assay that utilizes polymyxin B instead of gentamicin to rapidly kill extracellular organisms. Invasion measured by this assay was time and temperature dependent and was inhibited by the microfilament drug cytochalasin D. The invasion process was also dependent on a functional vir locus (also known as bvg), the positive regulator of virulence gene expression in B. pertussis. Four spontaneous Vir- phase variants of B. pertussis and a mutant with a transposon insertion mutation in the vir locus did not invade. Cells that were environmentally modulated and thus did not express virulence determinants also did not invade. Two Vir- mutants, a vir-directed plasmid insertion mutant and a UV-light-induced mutant, were capable of invasion, although they did not produce other known virulence factors such as pertussis toxin and hemolysin but did produce small amounts of filamentous hemagglutinin (FHA) and the 69-kilodalton outer membrane protein. None of 70 Tn5 IS50L::phoA (TnphoA) insertion mutants of strain Bp18323 (including three mutants defective in FHA) tested showed any reproducible defect in invasion. A mutant carrying a site-directed deletion mutation in FHA was also capable of invasion in our assay. These data suggest that there is redundancy in the invasion functions of B. pertussis and that one or more of these are coordinately regulated with FHA and the 69-kilodalton outer membrane protein more tightly than with other vir-activated gene products.

Bacterial Proteins↗

Evidence that modulation requires sequences downstream of the promoters of two vir-repressed genes of Bordetella pertussis.

Gene expression in Bordetella pertussis is altered by environmental signals in a process called antigenic modulation. In the presence of modulating signals, expression of several known virulence factors and outer membrane proteins is coordinately reduced. From a bank of TnphoA fusions, we have identified five genes whose expression profiles are reciprocal of those of the major virulence determinants; that is, alkaline phosphatase activity is maximal during growth in the presence of the modulators nicotinic acid and MgSO4 (S. Knapp and J. J. Mekalanos, J. Bacteriol. 170:5059-5066, 1988). We have called these loci vir-repressed genes (vrg). Two of these gene fusions (vrg-6 and vrg-18) have been cloned in Escherichia coli, returned on low-copy-number plasmids to several strains of B. pertussis, and found to be regulated similarly to the fusions harbored on the chromosome. Deletions of the two vrg promoters were constructed and returned to B. pertussis. Regulation was maintained even when all but 24 nucleotides upstream of the vrg-18 initiation codon and 60 nucleotides upstream of the vrg-6 initiation codon were deleted, suggesting that cis-acting regulatory elements of these genes lie very near or within the coding region. We observed a 21-base palindromic sequence overlapping an 8-base direct repeat within the signal sequence coding region of vrg-6; insertion of a 6-bp linker in this region abolished regulation. These repetitive sequences are also at the site of greatest primary sequence identify between vrg-6 and vrg-18 and correspond to the signal sequence coding region. We propose models that involve recognition of this region by a vir-regulated gene product.

Alkaline Phosphatase↗

[Sterility therapy of women in the course of time].

In all eras and cultures infertility has been regarded as one of the worst female diseases. Consequently, infertility investigation has always been one of the central diagnostic and therapeutic problems in medicine. We have attempted a summary of the tremendous evolution of infertility investigation and therapy, culminating in the modern concept of investigation and therapy of the infertile couple as a unit.

Female↗

Plasma levels of tetrahydrobiopterin and folate in major depression.

Plasma levels of tetrahydrobiopterin (BH4) and the related pterin folate were concurrently measured in 20 pairs of depressed patients and age-matched controls. The mean values of plasma BH4 in depressed patients was significantly elevated to a level about 150% of that found in the controls. Folate levels were not different between groups. These findings emphasize that BH4, a required cofactor in the biosynthesis of catecholamines and indolamines, is altered in depression.

Adult↗

Two trans-acting regulatory genes (vir and mod) control antigenic modulation in Bordetella pertussis.

Expression of virulence factors by Bordetella pertussis is altered by environmental signals (antigenic modulation) and is dependent on an activator encoded by a gene called vir. We have used TnphoA (Tn5 IS50L::phoA) gene fusions to define two sets of genes whose expression is either activated (vag loci) or repressed (vrg loci) by modulation signals. Both groups of genes appear to be regulated by the vir gene product in that, in the absence of modulators, null mutations in vir lead to the repression of vag gene fusions and derepression of vrg gene fusions. Mutants of B. pertussis were isolated that constitutively express virulence factors in the presence of the modulator MgSO4, nicotinic acid, or low incubation temperature. We designate the gene that carries such mutations mod (modulation) and have characterized one (mod-1) of these mod constitutive mutations. A method was developed for the insertional inactivation of the vir gene by using the integration of a suicide replicon. Inactivation of the vir gene in the mod-1 mutant, followed by transcomplementation with the cloned wild-type vir gene, gives the Mod-1 constitutive phenotype, showing that the mod-1 mutation defines a gene distinct from vir. The gene carrying the mod-1 mutation is linked to vir and was cloned on a recombinant cosmid (pLAF-C1) which transcomplements the vir-1::Tn5 mutation in B. pertussis 347. Introduction of pLAF-C1 into vir mutant and vir+ B. pertussis strains also gives the Mod-1 constitutive phenotype, indicating that mod-1 is a dominant allele. These data suggest that the mod gene product could have sensory functions for the environmental signals that affect the expression of vir-regulated genes of B. pertussis. The mod constitutive strains and plasmids described here also have applications in pertussis vaccine development.

Bordetella pertussis↗

A review of tort liability in involuntary civil commitment.

The grounds for liability in cases of involuntary civil commitment have been broadened in recent years. Psychiatrists and other mental health professionals have been found liable for infringement of civil rights under Section 1983 of the Civil Rights Act and for failure to commit an individual who is subsequently involved in a tragedy. This article reviews recent developments in tort liability in involuntary civil commitment as well as the traditional areas of tort liability, including malpractice, malicious prosecution, false imprisonment, and abuse of process. The authors believe that even in this climate of expanded liability, mental health professionals who follow the letter and spirit of civil commitment laws will continue to enjoy the broad protections from liability afforded them in the past.

Civil Rights↗