PubMed Health⌕ Search

Biomedical subjects

S L Hoffman

Publications and source records attributed to S L Hoffman.

At least 37 records · Page 2Linked to original sources
PubMed2001

Interleukin-12- and gamma interferon-dependent protection against malaria conferred by CpG oligodeoxynucleotide in mice.

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-gamma) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-gamma. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria.

Adjuvants, Immunologic↗
PubMed2001

Immunogenicity and protective efficacy of a Plasmodium yoelii Hsp60 DNA vaccine in BALB/c mice.

The gene encoding the 60-kDa heat shock protein of Plasmodium yoelii (PyHsp60) was cloned into the VR1012 and VR1020 mammalian expression vectors. Groups of 10 BALB/c mice were immunized intramuscularly at 0, 3, and 9 weeks with 100 microg of PyHsp60 DNA vaccine alone or in combination with 30 microg of pmurGMCSF. Sera from immunized mice but not from vector control groups recognized P. yoelii sporozoites, liver stages, and infected erythrocytes in an indirect fluorescent antibody test. Two weeks after the last immunization, mice were challenged with 50 P. yoelii sporozoites. In one experiment the vaccine pPyHsp60-VR1012 used in combination with pmurGMCSF gave 40% protection (Fisher's exact test; P = 0.03, vaccinated versus control groups). In a second experiment this vaccine did not protect any of the immunized mice but induced a delay in the onset of parasitemia. In neither experiment was there any evidence of a protective effect against the asexual erythrocytic stage of the life cycle. In a third experiment mice were primed with PyHsp60 DNA, were boosted 2 weeks later with 2 x 10(3) irradiated P. yoelii sporozoites, and were challenged several weeks later. The presence of PyHsp60 in the immunization regimen did not lead to reduced blood-stage infection or development of parasites in hepatocytes. PyHsp60 DNA vaccines were immunogenic in BALB/c mice but did not consistently, completely protect against sporozoite challenge. The observation that in some of the PyHsp60 DNA vaccine-immunized mice there was protection against infection or a delay in the onset of parasitemia after sporozoite challenge deserves further evaluation.

Animals↗
PubMed2001

Immunogenicity of well-characterized synthetic Plasmodium falciparum multiple antigen peptide conjugates.

Given the emerging difficulties with malaria drug resistance and vector control, as well as the persistent lack of an effective vaccine, new malaria vaccine development strategies are needed. We used a novel methodology to synthesize and fully characterize multiple antigen peptide (MAP) conjugates containing protective epitopes from Plasmodium falciparum and evaluated their immunogenicity in four different strains of mice. A di-epitope MAP (T3-T1) containing two T-cell epitopes of liver stage antigen-1 (LSA-1), a di-epitope MAP containing T-cell epitopes from LSA-1 and from merozoite surface protein-1, and a tri-epitope MAP (T3-CS-T1) containing T3-T1 and a potent B-cell epitope from the circumsporozoite protein central repeat region were tested in this study. Mice of all four strains produced peptide-specific antibodies; however, the magnitude of the humoral response indicated strong genetic restriction between the different strains of mice. Anti-MAP antibodies recognized stage-specific proteins on the malaria parasites in an immunofluorescence assay. In addition, serum from hybrid BALB/cJ x A/J CAF1 mice that had been immunized with the tri-epitope MAP T3-CS-T1 successfully inhibited the malaria sporozoite invasion of hepatoma cells in vitro. Spleen cells from immunized mice also showed a genetically restricted cellular immune response when stimulated with the immunogen in vitro. This study indicates that well-characterized MAPs combining solid-phase synthesis and conjugation chemistries are potent immunogens and that this approach can be utilized for the development of subunit vaccines.

Animals↗
PubMed2001

Multistage multiantigen heterologous prime boost vaccine for Plasmodium knowlesi malaria provides partial protection in rhesus macaques.

A nonhuman primate model for malaria vaccine development allowing reliable, stringent sporozoite challenge and evaluation of both cellular and antibody responses is needed. We therefore constructed a multicomponent, multistage DNA vaccine for the simian malaria species Plasmodium knowlesi including two preerythrocytic-stage antigens, the circumsporozoite protein (PkCSP) and sporozoite surface protein 2 (PkSSP2), and two blood stage antigens, apical merozoite antigen 1 (PkAMA1) and merozoite surface protein 1 (PkMSP1p42), as well as recombinant canarypox viruses encoding the four antigens (ALVAC-4). The DNA vaccine plasmids expressed the corresponding antigens in vitro and induced antiparasite antibodies in mice. Groups of four rhesus monkeys received three doses of a mixture of the four DNA vaccine plasmids and a plasmid encoding rhesus granulocyte-monocyte colony-stimulating factor, followed by boosting with a single dose of ALVAC-4. Three groups received the priming DNA doses by different routes, either by intramuscular needle injection, by intramuscular injection with a needleless injection device, the Biojector, or by a combination of intramuscular and intradermal routes by Biojector. Animals immunized by any route developed antibody responses against sporozoites and infected erythrocytes and against a recombinant PkCSP protein, as well as gamma interferon-secreting T-cell responses against peptides from PkCSP. Following challenge with 100 P. knowlesi sporozoites, 1 of 12 experimental monkeys was completely protected and the mean parasitemia in the remaining monkeys was significantly lower than that in 4 control monkeys. This model will be important in preclinical vaccine development.

Animals↗
PubMed2001

Incidence of symptomatic and asymptomatic Plasmodium falciparum infection following curative therapy in adult residents of northern Ghana.

Adult residents of holoendemic malaria regions in Africa have a naturally acquired immunity (NAI) to malaria that renders them more resistant to new infections, limits parasitemia, and reduces the frequency and severity of illness. Given such attributes, it is not clear how one might evaluate drug or vaccine efficacy in adults without serious confounding. To determine symptomatic and asymptomatic malaria attack rates in adults of northern Ghana, 197 men and women underwent curative therapy for any pre-existing malaria infections at the start of the high transmission (wet) season. They were monitored for first parasitemia and first clinical episode of infection by Plasmodium falciparum over a 20-week period (May-October 1996). The cumulative incidence of primary infection by P. falciparum was 0.98 and incidence density of infection was calculated to be 7.0 cases/person-year. Symptoms were reported by 19.5% of the individuals at the time of first recurrent parasitemia. Incidence of infection, parasite density, and the frequency of symptoms were comparable in males and females. The results suggest that NAI did not provide these adults with significant defense against rapid re-infection and suggest that this population-infection design could serve to demonstrate the efficacy of a drug or vaccine in preventing parasitemia.

Adolescent↗
PubMed2001

Induction of biologically active antibodies in mice, rabbits, and monkeys by Plasmodium falciparum EBA-175 region II DNA vaccine.

BACKGROUND: Plasmodium falciparum merozoites bind to and invade human erythrocytes via specific erythrocyte receptors. This establishes the erythrocytic stage of the parasite life cycle that causes clinical disease resulting in 2-3 million deaths per year. We tested the hypothesis that a Plasmodium falciparum ligand, EBA-175 region II (RII), which binds its erythrocyte receptor glycophorin A during invasion, can be used as an immunogen to induce antibodies that block the binding of RII to erythrocytes and thereby inhibit parasite invasion of erythrocytes. Accordingly, we immunized mice, rabbits, and monkeys with DNA plasmids that encoded the 616 amino acid RII. MATERIALS AND METHODS: DNA vaccine plasmids that targeted the secretion of recombinant RII protein with and without the universal T-cell helper epitopes P2P30 were used to immunize mice, rabbits, and Aotus monkeys. RII specific antibodies were assessed by IFA, ELISA, blocking of native [35S] labeled EBA-175 binding to human erythrocytes, and growth inhibition assays, all in vitro. RESULTS: The RII DNA plasmids were highly immunogenic as measured by ELISA and IFA. The anti-RII antibodies blocked the binding of native EBA-175 to erythrocytes, and rosetting of erythrocytes on COS-7 cells expressing RII. Most important, murine and rabbit anti-RII antibodies inhibited the invasion of merozoites into erythrocytes. We immunized nonhuman primates and showed that the RII-DNA plasmids were immunogenic and well tolerated in these monkeys. Monkeys were challenged with parasitized erythrocytes; one of three monkeys that received RII DNA plasmid was protected from fulminant disease. After challenge with live parasites, anti-RII antibody titers were boosted in the immunized monkeys. CONCLUSIONS: By proving the hypothesis that anti-RII antibodies can block merozoite invasion of erythrocytes, these studies pave the way for the clinical evaluation of EBA-175 as a receptor-blockade vaccine.

Animals↗
PubMed2000

Protection of Aotus monkeys by Plasmodium falciparum EBA-175 region II DNA prime-protein boost immunization regimen.

Aotus monkeys received 4 doses of Plasmodium falciparum EBA-175 region II vaccine as plasmid DNA (Dv-Dv) or recombinant protein in adjuvant (Pv-Pv) or as 3 doses of DNA and 1 dose of protein (Dv-Pv). After 3 doses, antibody titers were approximately 10(4) in DNA-immunized monkeys and 10(6) in protein-immunized monkeys. A fourth dose did not significantly boost antibody responses in the Dv-Dv only or Pv-Pv only groups, but titers were boosted to approximately 10(6) in monkeys in the Dv-Pv group. Four weeks after the last immunization, the animals were challenged with 10(4) P. falciparum-parasitized erythrocytes. Peak levels of parasitemia were lower in the 16 monkeys that received region II-containing plasmids or proteins than in the 16 controls (geometric mean: 194,178 and 410,110 parasites/microL, respectively; P=.013, Student's t test). Three of 4 monkeys in the Dv-Pv group did not require treatment. These data demonstrate that immunization with EBA-175 region II induces a significant antiparasite effect in vivo.

Adjuvants, Immunologic↗
PubMed2000

Infectious disease. Research (genomics) is crucial to attacking malaria.

Solving the enormous problem of malaria worldwide will require a balance between investments in research and control. In this point-counterpoint, two scientists describe the rationales for these very different strategies. Steve Hoffman believes that genomics research is the best investment in the future if we have the vision of malaria eradication. Chris Curtis presents an opposing viewpoint, that low-tech control approaches are the practical ones under current conditions.

Animals↗
PubMed2000

Differences in epitope recognition, isotype and titer of antisera to Plasmodium falciparum merozoite surface protein 4 raised by different modes of DNA or protein immunization.

Plasmodium falciparum merozoite surface protein 4 (MSP4) is being developed as a component of a subunit vaccine against asexual stages of malaria. Three DNA constructs were produced that induced expression of MSP4 either in the cytoplasm of transfected cells or secreted from cells under the control of the human tissue plasminogen activator (TPA) signal or the native P. falciparum MSP4 signal. Only the construct containing the TPA signal induced detectable antibodies in mice, although gene expression was demonstrated in all constructs and MSP4 was shown to be secreted using either signal by in vitro transient transfection of COS cells. Two recombinant MSP4 proteins that encoded the same sequence as the plasmid DNA were produced in E. coli (EcMSP4-His) and S. cerevisiae (yMSP4-His) and used to raise antibodies in mice. Comparison of the antibodies elicited by these various antigen formulations showed differences in titer, isotype and epitope recognition. The titer of antibodies induced by DNA vaccination was lower than that induced by yMSP4-His, which in turn was lower than that induced by EcMSP4-His. The isotype profiles of the antibodies were also different, the plasmid DNA induced predominantly IgG(2a) responses whereas the two proteins induced predominantly IgG(1) responses. The antibodies induced by DNA and yMSP4-His recognized predominantly the C-terminal epidermal growth factor (EGF)-like domain of the protein, whereas EcMSP4-His induced antibodies recognizing all domains of the protein equally. The antibodies induced by DNA vaccination were directed almost extensively to conformational epitopes so that reactivity with native MSP4 was abolished after disulfide bonds in the protein were disrupted. Antibodies induced by recombinant proteins recognized linear epitopes as well and reactivity to native MSP4 was preserved after reduction and alkylation of parasite proteins.

Animals↗
PubMed2000

Plasmid vaccine expressing granulocyte-macrophage colony-stimulating factor attracts infiltrates including immature dendritic cells into injected muscles.

Plasmid-encoded GM-CSF (pGM-CSF) is an adjuvant for genetic vaccines; however, little is known about how pGM-CSF enhances immunogenicity. We now report that pGM-CSF injected into mouse muscle leads to a local infiltration of potential APCs. Infiltrates reached maximal size on days 3 to 5 after injection and appeared in several large discrete clusters within the muscle. Immunohistological studies in muscle sections from mice injected with pGM-CSF showed staining of cells with the macrophage markers CD11b, Mac-3, IA(d)/E(d) and to the granulocyte marker GR-1 from day 1 through day 14. Cells staining with the dendritic cell marker CD11c were detected only on days 3 to 5. Muscles injected with control plasmids did not stain for CD11c but did stain for CD11b, Mac-3, IA(d)/E(d), and GR-1. No staining was observed with the APC activation markers, B7.1 or CD40, or with markers for T or B cells. These findings are consistent with the infiltrating cells in the pGM-CSF-injected muscles being a mixture of neutrophils, macrophages, and immature dendritic cells and suggest that the i.m. APCs may be enhancing immune responses to coinjected plasmid Ags. This hypothesis is supported by data showing that 1) separation of injections with pGM-CSF and Ag-expressing plasmid into different sites did not enhance immune responses and 2) immune enhancement was associated with the presence of CD11c+ cells in the infiltrates. Thus, pGM-CSF enhancement may depend on APC recruitment to the i.m. site of injection.

Adjuvants, Immunologic↗
PubMed2000

Recombinant attenuated Toxoplasma gondii expressing the Plasmodium yoelii circumsporozoite protein provides highly effective priming for CD8+ T cell-dependent protective immunity against malaria.

The protozoan parasite Toxoplasma gondii elicits strong cell-mediated immunity against itself as well as nonspecific resistance against other pathogens and tumors. For this reason, we asked whether recombinant Toxoplasma could be utilized as an effective vaccine vehicle for inducing immunity against heterologous microbial infections. The circumsporozoite protein (PyCSP) of Plasmodium yoelii was engineered into a T. gondii temperature-sensitive strain (ts-4), a mutant that induces complete protection against virulent Toxoplasma challenge. When administered to mice in a single dose, a recombinant ts-4 (CSC3) that both secretes and expresses surface PyCSP induced strong anti-CSP Ab responses, with an isotype distribution pattern similar to that stimulated by the T. gondii carrier. When challenged with P. yoelii sporozoites during the first month after CSC3 vaccination, these animals displayed substantial levels of nonspecific resistance attributable entirely to the T. gondii carrier. Nevertheless, after the nonspecific protection had waned, high levels (up to 79%) of specific immunity against sporozoite challenge were achieved by boosting the animals with recombinant vaccinia virus expressing PyCSP. These CSC3-primed PyCSP-vaccinia-boosted mice displayed high frequencies of splenic PyCSP-specific IFN-gamma-producing cells, as well as CD8+ T cell-dependent cytolytic activity. In vivo depletion of CD8+ lymphocytes at the time of challenge completely ablated protective immunity in the T. gondii-primed/vaccinia-boosted animals, while neutralization of IFN-gamma or IL-12 caused a partial but significant reduction in resistance. Together these findings establish the efficacy of recombinant attenuated Toxoplasma as a vaccine vehicle for priming CD8+-dependent cell-mediated immunity.

Animals↗
PubMed2000

The complexity of protective immunity against liver-stage malaria.

Sterile protective immunity against challenge with Plasmodium spp. sporozoites can be induced in multiple model systems and humans by immunization with radiation-attenuated Plasmodium spp. sporozoites. The infected hepatocyte has been established as the primary target of this protection, but the underlying mechanisms have not been completely defined. Abs, CD8+ T cells, CD4+ T cells, cytokines (including IFN-gamma and IL-12), and NO have all been implicated as critical effectors. Here, we have investigated the mechanisms of protective immunity induced by immunization with different vaccine delivery systems (irradiated sporozoites, plasmid DNA, synthetic peptide/adjuvant, and multiple Ag peptide) in genetically distinct inbred strains, genetically modified mice, and outbred mice. We establish that there is a marked diversity of T cell-dependent immune responses that mediate sterile protective immunity against liver-stage malaria. Furthermore, we demonstrate that distinct mechanisms of protection are induced in different strains of inbred mice by a single method of immunization, and in the same strain by different methods of immunization. These data underscore the complexity of the murine host response to a parasitic infection and suggest that an outbred human population may behave similarly. Data nevertheless suggest that a pre-erythrocytic-stage vaccine should be designed to induce CD8+ T cell- and IFN-gamma-mediated immune responses and that IFN-gamma responses may represent an in vitro correlate of pre-erythrocytic-stage protective immunity.

Amino Acid Sequence↗
PubMed2000

HLA-DR-promiscuous T cell epitopes from Plasmodium falciparum pre-erythrocytic-stage antigens restricted by multiple HLA class II alleles.

Previously, we identified and established the antigenicity of 17 CD8+ T cell epitopes from five P. falciparum Ags that are restricted by multiple common HLA class I alleles. Here, we report the identification of 11 peptides from the same Ags, cicumsporozoite protein, sporozoite surface protein 2, exported protein-1, and liver-stage Ag-1, that bind between at least five and up to 11 different HLA-DR molecules representative of the most common HLA-DR Ags worldwide. These peptides recall lymphoproliferative and cytokine responses in immune individuals experimentally immunized with radiation-attenuated Plasmodium falciparum sporozoites (irradiated sporozoites) or semi-immune individuals naturally exposed to malaria in Irian Jaya or Kenya. We establish that all peptides are recognized by individuals of each of the three populations, and that the frequency and magnitude of helper T lymphocyte responses to each peptide is influenced by the intensity of exposure to P. falciparum sporozoites. Mean frequencies of lymphoproliferative responses are 53.2% (irradiated sporozoites) vs 22.4% (Kenyan) vs 5.8% (Javanese), and mean frequencies of IFN-gamma responses are 66.3% (irradiated sporozoites) vs 27.3% (Kenyan) vs 8. 7% (Javanese). The identification of HLA class II degenerate T cell epitopes from P. falciparum validates our predictive strategy in a biologically relevant system and supports the potential for developing a broadly efficacious epitope-based vaccine against malaria focused on a limited number of peptide specificities.

Adolescent↗
PubMed2000

Improving protective immunity induced by DNA-based immunization: priming with antigen and GM-CSF-encoding plasmid DNA and boosting with antigen-expressing recombinant poxvirus.

Intramuscular immunization with a naked DNA plasmid expressing the Plasmodium yoelii circumsporozoite protein (pPyCSP) protects mice against challenge with P. yoelii sporozoites. This protection can be improved either by coadministration of a plasmid expressing murine GM-CSF (pGMCSF) or by boosting with recombinant poxvirus expressing the PyCSP. We now report that combining these two strategies, by first mixing the priming dose of pPyCSP with pGMCSF and then boosting with recombinant virus, can substantially increase vaccine effectiveness. Not only were immune responses and protection improved but the pPyCSP dose could be lowered from 100 microg to 1 microg with little loss of immunogenicity after boost with recombinant poxvirus. Comparing mice primed by the 1-microg doses of pPyCSP plus 1 microg pGMCSF with mice primed by 1-microg doses of pPyCSP alone, the former were better protected (60% vs 0) and had higher concentrations of Abs (titers of 163, 840 vs 5, 120 by indirect fluorescent Ab test against sporozoites), more ex vivo CTL activity (25% vs 7% specific lysis), and more IFN-gamma-secreting cells by enzyme-linked immunospot assay (1460 vs 280 IFN-gamma spot-forming cells/106 cells). Priming with plasmid vaccine plus pGMCSF and boosting with recombinant poxviruses strongly improves the immunogenicity and protective efficacy of DNA vaccination and allows for significant reduction of dose.

Animals↗
PubMed2000

Safety, tolerability and humoral immune responses after intramuscular administration of a malaria DNA vaccine to healthy adult volunteers.

DNA-based vaccines are considered to be potentially revolutionary due to their ease of production, low cost, long shelf life, lack of requirement for a cold chain and ability to induce good T-cell responses. Twenty healthy adult volunteers were enrolled in a Phase I safety and tolerability clinical study of a DNA vaccine encoding a malaria antigen. Volunteers received 3 intramuscular injections of one of four different dosages (20, 100, 500 and 2500 microg) of the Plasmodium falciparum circumsporozoite protein (PfCSP) plasmid DNA at monthly intervals and were followed for up to twelve months. Local reactogenicity and systemic symptoms were few and mild. There were no severe or serious adverse events, clinically significant biochemical or hematologic changes, or detectable anti-dsDNA antibodies. Despite induction of excellent CTL responses, intramuscular DNA vaccination via needle injection failed to induce detectable antigen-specific antibodies in any of the volunteers.

Adult↗
PubMed2000

Tropical medicine.

Explore the source record for details and available documents.

Elephantiasis, Filarial↗