PubMed HealthSearch

Biomedical subjects

S Macura

Publications and source records attributed to S Macura.

At least 19 recordsLinked to original sources

Analysis of error propagation from NMR-derived internuclear distances into molecular structure of cyclo-pro-gly.

Analytical expressions have been derived that translate uncertainties in distance constraints (obtained from NMR investigations) into uncertainties in atom positions in the maximum likelihood (ML) structure consistent with these inputs. As a test of this approach, a comparison was made between test structures reconstructed by the new ML approach, which yields a single structure and a covariance matrix for coordinates, and those reconstructed by metric matrix distance-geometry (MMDG), which yields a family of structures that sample uncertainty space. The test structures used were 560 polyhedra, with edges of arbitrary length containing up to 50 vertices, and one polyhedron, with 100 vertices; randomized distance constraints generated from these structures were used in reconstructing the polyhedra. The uncertainties derived from the two methods showed excellent agreement, and the correlation improved, as expected, with increasingly larger numbers of MMDG structures. This agreement supports the validity of the rapid analytical ML approach, which requires the calculation of only a single structure. As a second test of the ML method, the approach was applied to the determination of uncertainties in the structure of a cyclic dipeptide, cyclo(DL-Pro-Gly) (cPG), derived from NMR cross-relaxation data. The input data were interproton distances calculated from NOEs measured for a solution of the peptide in 2:1 DMSO:H2O at -40 degreesC (so as to yield large negative NOEs). In order to evaluate effects of the quality of the input spectral parameters on the precision of the resulting NMR structure, information from the covalent geometry of cPG was not used in the structure calculations. Results obtained from the analytical ML approach compared favorably with those from the much slower random-walk variant of the Monte Carlo method applied to the same input data. As a third test, the ML approach was used with synthetic structural constraints for a small protein; the results indicate that it will be feasible to use this rapid method to translate uncertainties associated with a given set of distance restraints into uncertainties in atom positions in larger molecules.

Dipeptides

Excitation of complicated shapes in three dimensions.

We experimentally verified a recently proposed technique for the excitation of a complicated three-dimensional profile (CARVE, completely arbitrary regional volume excitation). CARVE is based on a generalized DANTE RF pulse sequence and a synchronous string of gradient steps. Provided there is no limitation in the number of pulses, CARVE can generate an excitation profile of any shape with any resolution. However, hardware limitations and sample properties restrict the number of RF pulses and gradient steps and, thus, limit attainable resolution of the excitation profile. We theoretically and experimentally showed that spatial resolution can be increased by distributing a long sequence among several CARVE experiments and summing up their signals. This is particularly important for three-dimensional excitation profiles where an n-fold increase in resolution requires an n3-fold increase of the number of events in the sequence. The potential use of three-dimensional CARVE might be in spectroscopic imaging where the excitation profile can be tailored to match the shape of a selected organ or body part.

Magnetic Resonance Spectroscopy

Oxidation products of hyperforin from Hypericum perforatum.

The isolation of two oxidation products of hyperforin from the aerial parts of Hypericum perforatum and their structure determination by means of 2D NMR methods is reported. The products had the same 1-(2-methyl-1-oxopropyl)-2,12-dioxo-3,10 beta-bis(3-methyl-2-butenyl)-11 beta-methyl-11 alpha-(4-methyl-3-pentenyl)-5-oxatricyclo[6.3.1.0(4,8)]-3-dodec ene skeleton. In addition, one of them, with the same number of carbons as hyperforin (C35H52O5), contained a 1-methyl-l-hydroxyethyl group in the 6 beta-position, whereas the other compound (a hemiacetal, C32H46O5), presumably a degradation product of hyperforin, exhibited a 6-hydroxy function. The latter was an inseparable mixture of 6 alpha- and 6 beta-hydroxy epimers undergoing (according to phase sensitive NOESY) mutual interconversion.

Anti-Bacterial Agents

Zinc binding properties of the DNA binding domain of the 1,25-dihydroxyvitamin D3 receptor.

To assess the zinc binding stoichiometry and the structural changes induced upon the binding of zinc to the human vitamin D receptor (VDR), we expressed the DNA binding domain (DBD) of the human VDR in bacteria as a soluble glutathione-S-transferase fusion protein at 20 degrees C, and examined the apo-protein and metal-liganded protein by mass spectrometry, and circular dichroism and nuclear magnetic resonance spectroscopy. Following final preparation with a zinc-free buffer, the VDR DBD bound 2 mol of zinc/mol of protein as measured by inductively coupled plasma-mass spectrometry and electrospray ionization-mass spectrometry. When protein preparation was carried out in a zinc containing buffer and zinc content of the protein was assesed by the same methods, VDR DBD bound 4 mol of zinc/mol of protein. Analysis of the protein using circular dichroism spectroscopy demonstrated that the EDTA-treated protein increased in alpha-helical content from 16 to 27% on the addition of zinc. Equilibrium ultracentrifugal analyses of the VDR DBD indicated that the protein was present in solution as a monomer. Gel mobility shift analyses of the VDR DBD with several vitamin D response elements (VDREs) in the absence of accessory proteins such as retinoic acid receptor, showed that VDR DBD was able to form a protein/VDRE DNA structural complex. In the presence of zinc, proton NMR NOESY spectra showed that the protein possessed elements of secondary structure. The addition of VDRE DNA, but not random DNA, caused changes in the proton NMR spectra of VDRE DNA indicating specific interaction between protein and DNA groups. We conclude that the DBD of the VDR binds zinc and DNA and undergoes conformational changes on binding to the metal and DNA.

Amino Acid Sequence

Excitation of arbitrary shapes by gradient optimized random walk in discrete k-space.

A new technique for the excitation of arbitrary shapes is proposed. It is based on a parallel sequence of small tip angle RF pulses and gradient pulses. The small tip angle rotations co-add yielding a 90 degrees excitation pulse within the selected excitation profile while outside the profile, the rotations cancel each other. A full theory of the completely arbitrary regional volume excitation (CARVE) method is presented and experimentally verified. In CARVE, k-space is discrete because the RF is applied in pulses. The discrete character of k-space permits an arbitrary trajectory for the k-space walk. The optimal random trajectory is found by minimizing the gradient load using simulated annealing. It is shown, both theoretically and experimentally, that such a trajectory is much better than any other systematic or random trajectory in k-space.

Image Processing, Computer-Assisted

Identification of spin diffusion pathways in proteins by isotope-assisted NMR cross-relaxation network editing.

A new isotope-assisted cross-relaxation editing experiment, [1H-13C]DINE-NOESY[1H-15N]HSQC (DINE=Double INEPT Edited), is proposed. It is based on the selective inversion of CH/CH3 or CH2 protons in the middle of the mixing time. The experiment sorts out the spin diffusion paths according to the principal mediators, either the CH/CH3 or the CH2 protons. This is useful in the structure refinement process, as it enables proper alignment of the aliphatic protons in the vicinity of NH protons.

Amino Acid Sequence

Nitrogen-15 NMR chemical shifts in oligopeptides coordinated to cobalt(III).

Dipeptide, tripeptide, and tetrapeptide complexes with cobalt(III) ions were studied as model compounds for evaluation of 15N NMR chemical shifts induced in proteins upon binding transition metal ions. Coordination of oligopeptides to cobalt(III) resulted in large negative 15N NMR shifts for amine nitrogens (-76 to -32 ppm) and deprotonated amide nitrogens (-47 to -10). Coordination-induced shifts were affected by the nature of moiety at the trans position; the shifts were always larger with a carboxylato oxygen than with an amine nitrogen in the trans position. Thus, coordination-induced 15N NMR shifts provided direct and specific information on the stereochemistry of peptide coordination. Two new complexes, [Co(Gly-gly-gly-glyH(-3))(NH3)2] and Ba[Co(Gly-L-hisH(-2))(NO2)3], were synthesized and their structure was determined by NMR spectroscopy.

Amino Acid Sequence

Trinucleotide repeats that expand in human disease form hairpin structures in vitro.

We show that repeating units from all reported disease genes are capable of forming hairpins of common structure and threshold stability. The threshold stability is roughly -50 kcal per hairpin and is influenced by the flanking sequence of the gene. Hairpin stability has two components, sequence and length; only DNA of select sequences and the correct length can form hairpins of threshold energy. There is a correlation among the ability to form hairpins of threshold stability, the sequence selectivity of expansion, and the length dependence of expansion. Additionally, hairpin formation provides a potential structural basis for the constancy of the CCG region of the Huntington's disease gene in individuals and explains the stabilizing effects of AGG interruptions in FMR1 alleles.

Base Sequence

Somatostatin analogue octreotide modulates metabolism and effects of 5-fluorouracil and 5-fluorouridine in human colon cancer spheroids.

To examine if preferential retention of somatostatin analogues observed in some tumors might be used for modulation of effects of cancer drugs by co-treatment with long acting somatostatin analogues, the effects of somatostatin analogue octreotide on the kinetics of 5-fluorouracil (FUra) and 5-fluorouridine (FUrd) metabolism were studied by 19F NMR spectroscopy in multicell tumor spheroids comprised of human colon HT-29 adenocarcinoma cells. Octreotide stimulated the rate of formation of fluorouridinephosphates in FUra-treated cells, but inhibited this rate in FUrd-treated cells. Other elements of fluoropyrimidine metabolism were also altered by co-incubation with octreotide. A flow cytometric analysis indicated that FUra and FUrd arrested cells in the S phase, but co-treatment with octreotide almost eliminated the S-phase cells and induced the appearance of DNA fragments. These observations raise the possibility that somatostatin analogues can be used for specific modulation of fluoropyrimidine effects in tumors bearing somatostatin receptors.

Adenocarcinoma

Hairpin formation within the human enkephalin enhancer region. 2. Structural studies.

Receptor-mediated induction of the human proenkephalin gene has been mapped to an imperfect palindrome located between -104 and -86, upstream of the transcriptional start site. Several lines of evidence suggest that receptor-mediated transcription of proenkephalin involves a reversible conformational change from duplex to a hairpin state of the enhancer [McMurray, C.T., Wilson, W.D., & Douglass, J.O. (1991) Proc. Natl. Acad. Sci. U.S.A. 88, 666]. To determine the structure that would form if such a conformational change took place, we have synthesized two 23-bp oligonucleotides, d(GCTGGCGTAGGGCCTGCGTCAGC) and d(GCTGACGCAGGCCCTACGCCAGC), whose sequences are identical to the top and the bottom strands of the native enhancer. We have found that each oligonucleotide strand exists primarily as a hairpin structure over a wide range of oligonucleotide concentrations and a wide range of temperatures (0-45 degrees C). The assignment of each imino proton was carried out using 1D and 2D nuclear Overhauser effects (NOE) and by comparison with the spectra of hairpins containing single base substitutions. The hairpin structure for each oligonucleotide contains a 3-member loop, a 10-bp stem, and two mismatched pairs. The hairpin that forms from the top strand of the enhancer and contains two GT mispaired bases creates an alternative binding site for the cyclic adenosine monophosphate element binding protein (CREB), a transcription factor that binds to and regulates the human proenkephalin gene. Circular dichroism and 31P NMR indicate that, despite the presence of mismatched pairs, each oligonucleotide hairpin adopts a B-form conformation with no unusual bending or kinking. The structure of the hairpin may explain the effect on expression of point mutations within the enhancer.

Base Sequence

Solution structure of turkey ovomucoid third domain as determined from nuclear magnetic resonance data.

The solution structure of the 56 amino acid residue turkey ovomucoid third domain was determined by n.m.r. methods. Of the 661 distance constraints used in the calculations, 120 were determined by quadratic approximation of the cross-relaxation rates. The remaining constraints were crudely estimated from a more standard analysis of NOESY spectra. Additionally, 29 torsion angle constraints, 17 hydrogen bonds, and three disulfide bridges were used in the structure calculations. Stereospecific assignments were accomplished for 24 beta-methylene groups and six isopropyl methyl groups (43% chiral assignments). The addition of more accurate distance constraints to the distance geometry/simulated annealing approach resulted in a significant reduction in the dispersion of calculated backbone torsion angles and root-mean-square deviations between structures. Detailed comparisons have been made between the n.m.r. structures of OMTKY3 and published X-ray structures of the same protein and of closely related avian ovomucoid third domains. The refinement with more accurate distance constraints reduced differences between families of the n.m.r. and the X-ray structures.

Amino Acids

Refinement of the NMR solution structure of a protein to remove distortions arising from neglect of internal motion.

The effect of internal motion on the quality of a protein structure derived from nuclear magnetic resonance (NMR) cross relaxation has been investigated experimentally. Internal rotation of the tyrosine-31 ring of turkey ovomucoid third domain was found to mediate magnetization transfer; the effect led to underestimation of proton-proton distances in its immediate neighborhood. Experimental methods that distinguish pure cross relaxation from chemical exchange mediated cross relaxation were used to separate true distances from distorted ones. Uncorrected and corrected sets of distances, where the corrections took internal motion into account, each were used as input to a distance geometry program for structural modeling. Each set of distances yielded a family of similar (converged) structures. The two families of structures differed considerably (2 A) in the region of tyrosine-31. In addition, differences as large as 1 A were observed at other positions throughout the structure. These results emphasize the importance of analyzing the effects of internal motions in order to obtain more accurate NMR solution structures.

Amino Acid Sequence

Combined use of COSY and double quantum two-dimensional NMR spectroscopy for elucidation of spin systems in polymyxin B.

Two-dimensional single quantum correlation NMR spectroscopy (COSY) and two-dimensional double quantum NMR spectroscopy (2QT) are used to study spin systems in the 1H NMR spectrum of polymyxin B. Because of different frequency relationships, the two types of two-dimensional NMR experiments are found to be highly complementary. This is demonstrated by combined use of COSY and 2QT spectroscopy to obtain a complete analysis of the complicated spectral overlap which occurs in the 1H NMR spectrum of polymyxin B.

Magnetic Resonance Spectroscopy

[Osteosynthesis of the ribs in the unstable thoracic cage after injury with reconstruction using the AO plate].

Authors present 3 cases with stable osteosynthesis of the ribs in unstable chest. An operative technique of osteosynthesis with the reconstruction by an Ao-plate and screws K-3.5 has been shown. Indications for applying of stable osteosynthesis have been stressed, and are as follows:--unstable chest following injuries--polytrauma combined bu unstable chest,--open fractures of the ribs (when the space between the fragment is not too large),--injuries of the lungs, combined with the injury of the ribs create unstability of the chest,--pseudoarthrosis of many ribs, or permanently unstable chest,--when a respirator is not available, this treatment is mandatory. Authors have experimentally examined and compared the value of OS with the plate of Judet and they described the advantages, as well as disadvantages (poor fixation, migration of the plate danger of eventual injury of intercostal arteries a.o.). The results of two patients were excellent, while the third one died 5 weeks following the surgery, due to other causes. Although the internal stabilization of the chest with the aid of the respirator is a proved method, a lasting hospitalization is frequently complicated by this treatment; all this represents a basis for a new approach: AO plate, and an emergency osteosynthesis immediately following injury; this gives the best results so that authors consider it as revolutionary progress in the treatment of such injuries.

Adult

Simulated dipeptide recognition by vancomycin.

The antimicrobial activity of vancomycin and related glycopeptide antibiotics is due to stereospecific recognition of polypeptide components in bacterial cell walls. To better understand how these antibiotics recognize polypeptide determinants, we have developed dynamic models of the complexes formed by the vancomycin aglycon and two different dipeptide ligands, Ac-D-ala-D-ala and Ac-D-ala-gly. Molecular dynamics simulations of the two complexes, initially conditioned with distance constraints derived from two-dimensional nuclear magnetic resonance (NMR) studies, are conformationally stable and propagate in a manner consistent with the NMR-derived constraints after the constraints are removed. Free energy calculations accurately predict the relative binding affinity of these two complexes and help validate the simulation models for detailed structural analysis. Although the two ligands adopt similar conformations when bound to the antibiotic, there are clear differences in the configuration of intermolecular hydrogen bonds, the overall shape of the antibiotic, and other structural features of the two complexes. This analysis illustrates how complex structural and dynamic factors interrelate and contribute to differences in binding affinity.

Anti-Bacterial Agents